SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10706
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.438
 

Sequence

CDS
ATGGAAGAAATAAAAGACATGTTCTTGAGTTTGCAACAAGACATAAAACAACAAAAAGAAGATATGGTAAAGATGAAGGAAGACATCAAAAACATAATAGTTAACAGCCTTGCCGAGAAGTTAAGCAGCTTAGAACTTAAAAACGAGCTTTTAGAACAAAAAATTGAAGAACAAAATAGAAAGATGAACAACTTAGAAAGACAGTCTAGACGCAAAAACTTGGTCATGTTTGGTGTAGAAGAGCGCGAAAACTCATACCACGAACTTGAAGAAATGATAATCAGCATAATAAATACAAATTTTAAAGTATCCTGCGAAACTAACAGCATTGAAGCAGTACGTAGGTTGGGAAAAAAGGGAGAGAAGACCAGACCAGTAGTAATAACGTTCAACACATTAGGATTAAAACTAAAAATTCAGAAAGACAAATATTGTTTACAAAAAACCGCATACTACATAAAAGAAGACTATCCAATTGAAATCTTAAAAAAGCGCAAAGAGTTGCAAGCCCAGTTAGAGAGGGAAAAAGAAGCAGGAAATAGAGCAATTATAAGATATGACAAACTTATCATACTGAATAAAAAACATTCTCCCCGCAATCAACCAAACAAGAGATACCTTTCCGAATCCCCGGAGACACCTATGACTGCTAGCCAAGAAACTCAACACGTTGAAAAACAACCTTTGAAGAAAACCAAAGCGAGGAACATGAAAAGCTACATAACACAGACGCCCAAACTAGCAGCGTTACAAGGCATCAACCACGATGTAATAGGACTGTGCGAAGTCCGCCGCTTTGGTGAAAAGATAATCGAAGATGACAAATACATTATGTACCACATAGGCCAAACCAAAGGACTGCACGGGGTAGGCTTCCTAATCAAGAAGATACACAAAGAAAATATCATATCATTCACAGGTATATCTGAGAGAGTGTGCATACTAGAAATCGTGCTAGAAAAGATACGTCTCGCAATTATCCAGGCATATGCCCCAACTGAAAACTCGTCGCAAGAAGATATAGATAACTTTTACGACGACCTGGAGAAAGCGCATGACTCAACCTGTACGAAATATATAATTTCTATGGGAGATTTTAACGCACAAATAGGGACTACCAAGAAGTATGAATGTTCCGCTACCGGCAAGTATGGACATGGTATCAGGAAGATTATAAATATAGCTACCAACTTTTACACTAAATTATACAGTCAACCAGACATTAATCCACTGAGGAAAAAAGATATCTTTAGTCATACTAATACCTCATCTGTACAACGCTTTTCCGAGTCTGAAGTCTTAAGACAAGTAAAGAAACTTAAGTCAGAAAAGAGCCCAGGACCAGATGGCATTACCAACGAATACATCAAGTTAGCTAGAACCTTACTATTGACACCAATCACCATCTTATGGAACAAAATACTTGAAGAAGAAACTGTGCCGCAGCTATGGAGGGAGTCTGAGATTATATTACTATATAAAAAAGGTAATCCAGCTGACATAGGGAATTACCGCCCGATTAGCCTTATGCCCTGTTTATATAAATTATGTGCCTCCTGCCTACTTGAAAGAATATCCTCCAGCATTGATTCACACCAGCCGATAGAGCAAGCTGGCTTCAGAACGGGTTTTAGCACGGCAGACCATATTCAAGTTGTCGACCAGGTTATCGAAAAATACTTAGAGTTCCAAAGGCCCCTATACCTGGCTTTTGTAGATTATAAAAAAGCTTTCGACTCTATATCACACGACAGTATCTGGGAAGCTTTACATGCATTAAATATTCAAGAAAAATACATTAGCATTCTAAAAAACATTTATACCAACTGCACAAGTAAAGTTAAGCTAGATAGAATCGGAGCAACAATCAACATAAAGAGGGGAGTCCGTCAAGGCGATCCTCTATCCCCAAAACTGTTTATAGCCGTCTTACAACAGATAACGAGCAATTTACCATGGTCTAAAAAAGGGATTAACATAAATGGAAGCTATCTGAGCCATCTCGAATTTGCAGATGACGTTATACTATTTTCTGAATGCCCACAACAATTGAGTATAATGATAAATGAATTACATCAAGCTAGCTCAAAAATTGGCTTAGAAATGAACCTCGAGAAAACGAAAGTAATGACTAATCACCATACGTTACCAATCTCTATCAACAACATTCCTCTTGAAATTGTAGAAAAATATGTATATTTAGGAAAGCAAATATCTTTTAGAAGGGAGAGACACTCAGAAGAAGTGGACCGACGAGTCGCCATGACCTGGAAAAAGTATTGGGCTTATAAGGAAATTTTCAAATCGCAACTGCCATTGTCCACTAAGAAGATAGCCATGGACACAACTATACTACCATGCCTGACCTATGGGTGTCAATCATGGACATTTGATTTCAAAACGAAAAATAAAATCCAGACCACTCAGAGAAAAATGGAAAGAAGTATTATGGGCTTAAAACTTAAAGACAAGGTGAAATGCACGAATGTCCGTCAGAAAACGAAAATAACAGATGCTTTAACATTCTCGCTACAGAGGAAATGGAAATGGGCAGGCCATCTGGCTAGATACAACGACAACAGATGGACAAAAAGATCGGTCGTATGGACAGGTCCACGAGGAAAGAGAGCTAAAGGCCGCCCCTACGCTAGGTGGGTAGACGAAATTATAACAGTGGCTGGTAAAGATTGGCTGAATATCGCCAAGGATAAGAAGAAGTGGAGTACCTTAGAGGAGGCTTTTACCCGAAGGGGGTCCATACAGAAATAA
Protein
MEEIKDMFLSLQQDIKQQKEDMVKMKEDIKNIIVNSLAEKLSSLELKNELLEQKIEEQNRKMNNLERQSRRKNLVMFGVEERENSYHELEEMIISIINTNFKVSCETNSIEAVRRLGKKGEKTRPVVITFNTLGLKLKIQKDKYCLQKTAYYIKEDYPIEILKKRKELQAQLEREKEAGNRAIIRYDKLIILNKKHSPRNQPNKRYLSESPETPMTASQETQHVEKQPLKKTKARNMKSYITQTPKLAALQGINHDVIGLCEVRRFGEKIIEDDKYIMYHIGQTKGLHGVGFLIKKIHKENIISFTGISERVCILEIVLEKIRLAIIQAYAPTENSSQEDIDNFYDDLEKAHDSTCTKYIISMGDFNAQIGTTKKYECSATGKYGHGIRKIINIATNFYTKLYSQPDINPLRKKDIFSHTNTSSVQRFSESEVLRQVKKLKSEKSPGPDGITNEYIKLARTLLLTPITILWNKILEEETVPQLWRESEIILLYKKGNPADIGNYRPISLMPCLYKLCASCLLERISSSIDSHQPIEQAGFRTGFSTADHIQVVDQVIEKYLEFQRPLYLAFVDYKKAFDSISHDSIWEALHALNIQEKYISILKNIYTNCTSKVKLDRIGATINIKRGVRQGDPLSPKLFIAVLQQITSNLPWSKKGININGSYLSHLEFADDVILFSECPQQLSIMINELHQASSKIGLEMNLEKTKVMTNHHTLPISINNIPLEIVEKYVYLGKQISFRRERHSEEVDRRVAMTWKKYWAYKEIFKSQLPLSTKKIAMDTTILPCLTYGCQSWTFDFKTKNKIQTTQRKMERSIMGLKLKDKVKCTNVRQKTKITDALTFSLQRKWKWAGHLARYNDNRWTKRSVVWTGPRGKRAKGRPYARWVDEIITVAGKDWLNIAKDKKKWSTLEEAFTRRGSIQK

Summary

Pfam
PF00078   RVT_1
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
SUPFAM
SSF56219   SSF56219       
Gene 3D
ProteinModelPortal
PDB
6AR3     E-value=0.00656139,     Score=97

Ontologies

GO

Topology

Length:
922
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01505
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00001
outside
1  -  922
 
 

Population Genetic Test Statistics

Pi
38.637667
Theta
25.773078
Tajima's D
-0.795435
CLR
161.076529
CSRT
0.184790760461977
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号