SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10700
Pre Gene Modal
BGIBMGA008244
Annotation
PREDICTED:_LOW_QUALITY_PROTEIN:_xanthine_dehydrogenase_1-like_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.823
 

Sequence

CDS
ATGCCGCGATCACAGAGCGCTCATGCGATCGTCAACGCAGCGTACCTATACAAACTGAATAGCAACGGCACGGTGATAGAGTGCAGAATCAGCTACGGAGGTCTATCTTCACAATTTACCAGAGCTTTCGCGACTGAAAGCTTCTTAGTCGGTAAAGCTCTCTTCACGAACAACACTCTACAGAGAGCTCTTAATATACTGAAAAACGAACTGGTCGTGACAGAGATGCCGCCTGAACCTTCGGCAAAATATAGAGAGAAATTAGCTTTGAATCTATTTTATAAGGGACTCCTAACGCTTTGTCCAAACAATCAGCTGAATTCCCGCTATCGATCAGGTGCTATTAAGATCCATGAGACACGACCCGTATCCGAAGGCAGACAAATCTTTGACACCAATCCTACGGAATGGCCTTTAGGTCAACCCATACCCAAAGTTGAGGCTTTGATCCAATGCGCTGGAGAAGCCCATTTTTCTGAAGACATACCAACCTTACCTCGTGAAGTGTTTGCCGCTTTTGCATTGAGTACAATATCTAAAGGAGACCTTGTGAAAATAGATCCATCTCAAGCTCTGAACGTACCCGGAGTGATTGCATTTTACTCAGCGAAGGACATTCCTGGTGAAAATTCCTTTACACCAGCTCAAACTCTATTTTACATTGCTAACGAAGAAGTCTTCTGCAGCAGCAAAGTTGAATATTTCAATCAACCCATAGGAATGATTGTAGCGGAGACCCAACAAATAGCTGACCGTGCAGCCAAACTGGTGAAGGCTAAATATGCCAACATTAAAAAACCAGTCATAGACATCAAAGAAGCTAAGAAGGATCCGAAAAGGAATACTTTGTTTACTTCTATGGAAGCAACAGACAGAGGTACCGATGTAGTCAAACTTATTAAAGGCAGTAACACAATTTATGGTCAGTACCATTTTATGATGGAGAATTTGAGCTGTGTGACTAAGCCTACAGAAGAGGGTTTGGAAGTCCACTCAGCCACACAATGGATGGATGGAACCCAGGTCATGATTTCAAAGGCATTGAATATTGACTGCAATCGGATCGATGTGCATGTTAGACGTCTCGGAGGAGCTTATGGCATGAAGATTTCTCGCCCAATCCAAGTAGCGATCGCCTGCAGTCTTGCTGTTCAGAAGTTGAACAGACCCTGCCGATTTATTCAGTCGTTGACCACCACCACGAGGGCTATTGGAAAAAGACTTCCGTGCTCTACCGATTTCGAGGTATTTCCGATATGTTTAACATCAATAAATAGTAATTATGGTACCGCCTCCTGGAGACTTACTTTCTAA
Protein
MPRSQSAHAIVNAAYLYKLNSNGTVIECRISYGGLSSQFTRAFATESFLVGKALFTNNTLQRALNILKNELVVTEMPPEPSAKYREKLALNLFYKGLLTLCPNNQLNSRYRSGAIKIHETRPVSEGRQIFDTNPTEWPLGQPIPKVEALIQCAGEAHFSEDIPTLPREVFAAFALSTISKGDLVKIDPSQALNVPGVIAFYSAKDIPGENSFTPAQTLFYIANEEVFCSSKVEYFNQPIGMIVAETQQIADRAAKLVKAKYANIKKPVIDIKEAKKDPKRNTLFTSMEATDRGTDVVKLIKGSNTIYGQYHFMMENLSCVTKPTEEGLEVHSATQWMDGTQVMISKALNIDCNRIDVHVRRLGGAYGMKISRPIQVAIACSLAVQKLNRPCRFIQSLTTTTRAIGKRLPCSTDFEVFPICLTSINSNYGTASWRLTF

Summary

Cofactor
FAD
Mo-molybdopterin
[2Fe-2S] cluster
EMBL
BABH01034979    BABH01034980    BABH01034981    NWSH01000648    PCG75033.1    ODYU01003306    + More
SOQ41884.1    RSAL01000123    RVE46648.1    NWSH01007964    PCG62736.1    KZ150165    PZC72655.1    KZ150135    PZC72996.1    PZC72656.1    KQ459606    KPI91000.1    KQ460326    KPJ15693.1    PCG75032.1    KPI90999.1    JTDY01003022    KOB70290.1    JTDY01003126    KOB70107.1    PCG62737.1    KPI90998.1    PZC72997.1    ODYU01000376    SOQ35055.1    KPJ15694.1    LC017755    BAR64769.1    ODYU01000882    SOQ36316.1    KY595781    ARS46835.1    ODYU01001481    SOQ37735.1    PCG62735.1    KPI90997.1    BABH01034958    BABH01034959    BABH01034960    BABH01034961    BABH01034962    BABH01034963    BABH01034964    BABH01034965    RSAL01000088    RVE48202.1    ODYU01002094    SOQ39169.1    LC017758    BAR64772.1    KY595780    ARS46834.1    KQ459674    KPJ20482.1    BABH01001558    KQ459193    KPJ03064.1    KQ461154    KPJ08620.1    AGBW02011403    OWR46707.1    ODYU01005636    SOQ46683.1    KPJ15692.1    JTDY01003017    KOB70302.1    NWSH01007172    PCG63055.1    RSAL01001905    RVE40636.1    KPJ03063.1    LC017753    BAR64767.1    NWSH01000413    PCG76559.1    PCG76560.1    KY595779    ARS46833.1    KQ461196    KPJ06623.1    EU073423    ABW71271.1    RSAL01000229    RVE43893.1    NWSH01002143    PCG69059.1    RVE48204.1    JTDY01000607    KOB76483.1    BABH01001657    BABH01001658    BABH01001659    BABH01001660    PCG76561.1    PCG76558.1    KP899547    AKQ06146.1    AGBW02010767    OWR47879.1    KF960795    AII21997.1    KK852888    KDR14320.1    CVRI01000075    CRL08602.1    KPI90909.1    KY643683    AQY62686.1    KP899546    AKQ06145.1    KF960794    AII21996.1    ODYU01001878    SOQ38698.1    ODYU01004253    SOQ43930.1    ODYU01002537    SOQ40155.1    GEYN01000003    JAV02126.1    KC952900    AGQ43599.1    KF960796    AII21998.1    KPI90901.1    KPJ06614.1    NEVH01007404    PNF35793.1    LC017754    BAR64768.1    GFDL01004496    JAV30549.1    GL447829    EFN85870.1    KQ435826    KOX72014.1    KY595778    ARS46832.1    KZ288369    PBC26783.1    JR045677    AEY60027.1    DS232324    EDS40039.1    RSAL01000295    RVE42846.1    EDS40053.1    ODYU01002835    SOQ40809.1    EDS40041.1    AGBW02008082    OWR54176.1    CH477377    EAT42288.1    KQ460556    KPJ13979.1    ODYU01004588    SOQ44620.1    EAT42289.1    AXCN02000553    ODYU01010390    SOQ55467.1    ACPB03021369    ACPB03021370    GALX01003009    JAB65457.1    LC017752    BAR64766.1    JXUM01061540    KQ562154    KXJ76552.1    KQ971466    EFA13012.2   
Pfam
PF01315   Ald_Xan_dh_C        + More
PF03450   CO_deh_flav_C
PF02738   Ald_Xan_dh_C2
PF01799   Fer2_2
PF00941   FAD_binding_5
PF00111   Fer2
PF01130   CD36
Interpro
IPR002888   2Fe-2S-bd        + More
IPR016208   Ald_Oxase/xanthine_DH       
IPR000674   Ald_Oxase/Xan_DH_a/b       
IPR036318   FAD-bd_PCMH-like_sf       
IPR036884   2Fe-2S-bd_dom_sf       
IPR008274   AldOxase/xan_DH_Mopterin-bd       
IPR005107   CO_DH_flav_C       
IPR001041   2Fe-2S_ferredoxin-type       
IPR036010   2Fe-2S_ferredoxin-like_sf       
IPR036683   CO_DH_flav_C_dom_sf       
IPR006058   2Fe2S_fd_BS       
IPR016166   FAD-bd_PCMH       
IPR037165   AldOxase/xan_DH_Mopterin-bd_sf       
IPR002346   Mopterin_DH_FAD-bd       
IPR036856   Ald_Oxase/Xan_DH_a/b_sf       
IPR016169   FAD-bd_PCMH_sub2       
IPR012675   Beta-grasp_dom_sf       
IPR002159   CD36_fam       
IPR006621   Nose-resist-to-fluoxetine_N       
SUPFAM
SSF55447   SSF55447        + More
SSF56176   SSF56176       
SSF56003   SSF56003       
SSF47741   SSF47741       
SSF54665   SSF54665       
SSF54292   SSF54292       
Gene 3D
PDB
3UNI     E-value=1.53277e-37,     Score=392

Ontologies

Topology

Length:
437
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.03281
Exp number, first 60 AAs:
0.01724
Total prob of N-in:
0.00778
outside
1  -  437
 
 

Population Genetic Test Statistics

Pi
322.065991
Theta
232.473421
Tajima's D
1.753145
CLR
0.046214
CSRT
0.83890805459727
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号