SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10698
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Full name
RNA-directed DNA polymerase from mobile element jockey      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 2.434
 

Sequence

CDS
ATGGAGTCGCGGGTACAAAAAAATGCCACCCATGGGGACCCGTCGGTGCGCCCAGTCACGGCCGGAGTTCCCCAGGGAAGCGTCCTGGCACCAGTCCTCTACGCTCTCTACACCAACGACATTCCCACGCTTGAGGGCAACCTCCAAGCGTGGGAAGCCGACGTGAAGTTGGCGCTGTTTGCCGACGACAGCGCCTACTTCTCGTCCTCTAATTTCCCCTCTGCGGCCATTTCGAGGATGCAGAGGCTGTTGGACCTACTGCCCCAGTGGCTGGACCGATGGAGGGTCGCGGTCAACGTGGGGAAGACCGCGGCTATCCTCTTCGGTCCGGTCCGCACAAGAGTCGTCCCAGGACAGCTCAGTCTCCGTGGAGTCAATGTCGAGTTTAGGCCCAGTGTCCGATACCTGGGAGTCAATATCGACCGGAGTTTGAGGATGACCGCCCACGCCAAGTCGGCGTTGGCGGCCGCCCGCTATGCGAGGTTTCTCCTCCGGCCGGTGTTGGCCTCCAGGTTGCCGACCAGGACTAGACTCGGCATTTACAAGACGTATGTTCGTTCCCGTATCACGTACGCAGCTGCGGCCTGGTATCACCTCATCCCGCAGATCATGCGGGTGAAGTTACAGGCCCAGCAGAATCTGGCTCTTCGCACGATAGTCGGAGCAGGGCGTTACGTCAGAAATGACGTAATCGCCCGGGATCTAGATGTGGAGTCGCTCGAGGAGTTCATTCGGAGGCTAGCTCGTAATATGTACGAGCGGGCTGACGGTGGACCCCACGAGCATCTCCACAATATAGCTCCCTTGCACGCCAGACCACCTGATGGTAGGGCGCTACCAAGGGAGCTACTGGAACCCCCGGCTATGGGAGCTTCGTCCCGGGCAGTGGGGATTGCCCCGAGGCCCGTTCCGTGCCCCCGAAAGGGGGTACGACGACCCTTCTTCTTCTTCTCATGGGGACCACATGGCAAAAACAATTAA
Protein
MESRVQKNATHGDPSVRPVTAGVPQGSVLAPVLYALYTNDIPTLEGNLQAWEADVKLALFADDSAYFSSSNFPSAAISRMQRLLDLLPQWLDRWRVAVNVGKTAAILFGPVRTRVVPGQLSLRGVNVEFRPSVRYLGVNIDRSLRMTAHAKSALAAARYARFLLRPVLASRLPTRTRLGIYKTYVRSRITYAAAAWYHLIPQIMRVKLQAQQNLALRTIVGAGRYVRNDVIARDLDVESLEEFIRRLARNMYERADGGPHEHLHNIAPLHARPPDGRALPRELLEPPAMGASSRAVGIAPRPVPCPRKGVRRPFFFFSWGPHGKNN

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  RNA-directed DNA polymerase from mobile element jockey
EC Number
2.7.7.49
EMBL
RSAL01000708    RVE41206.1    ABLF02017815    ABLF02029291    ABLF02021994    ABLF02023911    + More
ABLF02041765    ABLF02041767    GGMS01013269    MBY82472.1    KK113014    KFM59099.1    ABLF02066620    GGMS01004685    MBY73888.1    GGMS01017914    MBY87117.1    ABLF02016494    ABLF02066976    ABLF02008463    ABLF02008153    ABLF02008462    ABLF02008464    ABLF02034467    ABLF02033522    ABLF02055645    ABLF02021177    ABLF02027367    ABLF02066338    ABLF02060395    GGMR01004661    MBY17280.1    ABLF02042518    ABLF02057746    GALX01005359    JAB63107.1    ABLF02010251    ABLF02035981    KQ459580    KPI99178.1    KQ459259    KPJ02068.1    ABLF02049496    ABLF02025082    ABLF02039175    ABLF02041809    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    KQ459265    KPJ02064.1    GBHO01041571    GBHO01005400    GBHO01005396    JAG02033.1    JAG38204.1    JAG38208.1    ABLF02004189    ABLF02005775    ABLF02015592    ABLF02057149    ABLF02058897    GEZM01074951    JAV64378.1    GGMR01019198    MBY31817.1    GBHO01041572    GBHO01041570    GBHO01010553    JAG02032.1    JAG02034.1    JAG33051.1    ABLF02034494    ABLF02003739    ABLF02003740    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    ABLF02029306    ABLF02029314    ABLF02060138    ABLF02014862    ABLF02014866    ABLF02061908    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    ABLF02003961    ABLF02059872    GGMR01000167    MBY12786.1    ABLF02008933    KB632361    ERL93526.1    GALX01005300    JAB63166.1    GFTR01008038    JAW08388.1    GEZM01053022    JAV74219.1    GFTR01008279    JAW08147.1    KU543687    AMS38379.1    APGK01020047    KB740155    ENN81216.1    NEVH01000598    PNF43535.1    GALX01005299    JAB63167.1    GGMS01012005    MBY81208.1    NEVH01015305    NEVH01006671    PNF27154.1    PNF37357.1    NEVH01017559    PNF23833.1    KQ971729    KYB24751.1    GEZM01008457    JAV94772.1    GEBQ01017345    JAT22632.1    KK116883    KFM69009.1    ABLF02029215    AB018558    BAA76304.1    GGMS01000737    MBY69940.1    IAAA01035747    LAA09607.1    ABLF02038199    ABLF02038200    ABLF02038201    ABLF02038202    ABLF02038205    NEVH01023961    PNF17613.1    M22874    M38643    AY089343    AAL90081.2    NEVH01007841    PNF34974.1    NEVH01000280    PNF43672.1    NEVH01005938    PNF38077.1    NEVH01023962    PNF17612.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01018383    PNF23463.1    NEVH01007443    PNF35684.1    NEVH01003017    PNF40781.1    NEVH01020071    PNF21969.1    AF081101    AAC72919.1    GEDC01012749    JAS24549.1    AB055391    BAB21761.1    NEVH01010546    PNF32261.1    NEVH01017470    PNF24199.1    ABLF02061876    KQ973342    KXZ75569.1    NEVH01014858    PNF27387.1    NEVH01012084    PNF30905.1    NEVH01019376    PNF22596.1    NEVH01002994    PNF40916.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF10551   MULE
PF13843   DDE_Tnp_1_7
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR006579   Pre_C2HC_dom       
IPR036875   Znf_CCHC_sf       
IPR018289   MULE_transposase_dom       
IPR029526   PGBD       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
326
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.18152
Exp number, first 60 AAs:
0.18922
Total prob of N-in:
0.15190
outside
1  -  326
 
 

Population Genetic Test Statistics

Pi
589.048132
Theta
234.194891
Tajima's D
4.664313
CLR
0.306824
CSRT
0.99990000499975
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号