SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10693  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA008268
Annotation
PREDICTED:_xanthine_dehydrogenase_2-like_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.09 PlasmaMembrane   Reliability : 1.433
 

Sequence

CDS
ATGGTAACTATGGGAGAATTCCTGCAGACAAACATGCGAGGAACGGTTATATTAAACGTTATGTTGCCTCCTTTGAATAAGACCTATTTGGTTACAACTATGAAGATAATGCCTAAATCCCAAAATGCGCACGCTATAGTCAATGCTGGTTTTCTATACAAATTAGCCAATAATTCGATAGTCACTCAAGCCAGGATCGTCTACAACGGCATCTCACCGACATTCGTAAGGGCTTTAGGAACCGAGAATTTCCTAATCGGAAAACCGTTGTTTAAAAACGAAACTCTTCAGTCGGCTTTGAACATTTTGAAGAAGGATCTGAACGCCACTGAAATGCCTCCCGAACCAAGCCCAGCGTATAGACAGCAGCTGGGTTTGGCAATGTTTTATAAGGGTCTCTTATATTTTTGTCCATCAAACAACATAAATCCGAGGTATCTCTCTGGAGCTACATTTCTCCGTAAGGCAAGACCTTTATCACGTGGAGAGCAAAATTATGAAACAAATGCTGCACTTTGGCCTTTAAATCAGCCAATCCCAAAGTTAGAATCGTTGATACAATGTGCAGGTGAAGCAGAGTATGTGGATGACATACCCTCGCTACCTTATGAAGTATTTGGTGCGTTCGTTTTAAGTACTGTTGCTCTGGGACAGATCGCCTCTATAGACGCTTCAGAAGCTTTGAAAATGAAAGGAGTTATAGCATTCTACACGGCTAAAGACATTCCTGGAAAAAATTCGTTCATTCCAAAAGAAGAGTATAATACGTCAGATGAAGAGATTCTTTGTTCTGGGGACGTCAAATACTATAATCAACCTTTGGGGATAATTGTAGCTGAACTTCAACATATCGCTATAGTCGCTGCTAAAAGTGTTAAAGTCAAGTATACAAATATCCGGAAACCAGTACTAGATATTAGTGATGCTATAAAAGACCCAAAGAGAAATTCAATACTAGTCTCTGTAGACGCAACGACTAGAGGTCATGATACCAGACAAGTTGTCAAAGGAAACGCCACTATTTATGGGCAATACCACTTTAGTATGGAAATTTTAGTTTGTGTAACGCTTTCAACTGAAGAAGGATTACAGGTCTATCCTTCTGTCCAAAATATGGATGGTGTGCAGGCTGTGATATCAAAAGCTTTGAATTTAGACGCTAATAGGATAGACATAAAAGTCCGACGCTTAGGAGGTTCTTACGGTATCAAGGTCACGAGGTCCAACCAAGTAGCTGTGTCGTGCAGTTTGGTATCATTCAAATTGAACAGGCCATGTCGCTTCGTACTTCCACTCTCAACTACTACAAGAGCTTACGGAAAGAGATTTCCGTGTATTGCTGATATGGAAGCTGGAATAAACCGAAGTGGAATAATTCAATACTTAAATTTCAAATTGTACGAAGACAATGGTTATAAAGTAAATGAGATCATACCTTCAATCAGTAGAGATGTTTATAATAACTGCTATGAAAAATCTACGTGGTCATTTCAGTGTATTAATACAATCACCGATACTGCTAAAAACAGCTGGTTCAGAGCACCTGGCACACTAGAGGCTGTGTCATTCGTTGAATTATTCATGGACAGAATTGCCTACGAAGCAAATTTAGATCCTATAGAATTAAGGCTTGCTAACTTAGATCCAGAACATAAAGATCTAAGAGAAATGCTTGACACTTTAATGAAGGAATCCAAATATAAAGAACGAAGAAAAGCAGTTGAAATTTTTAATAAGAATAACAGATGGCTGAAAAAGGGATTGCGTTTTAGTTTCTTGAAATGGGCTAGCACTATTGCCCCTTATTTTGATGTAAATATATCAGTTTATCATGTAGACGGTACTGTGTCATTGACCCATGGCGGAATAGAAATGGGTCAAGGTATAAACACAAAAGCAGCACAGATCTGTGCGTATTTTCTAAAAGTCCCGTTAGAAAAAGTTCAAGTTAAAGCAACGAATACCAATACCTGTCCCAACAGCTCTATTACTGCTGGTAGCTTTACGATACTTAGTATAGGAATAGGTGTTGAGAGGAGTTGCAAAGATTTGTTGCAGAGATTGGAACCGATCAGATCCAAAATGCCTTATGCCACGTGGCAAGAATTGATAGCCAAAGCGTTTGAAGAAAATGTTGATTTACAAGCTCACGGCTTCGTAAATAGGAATGATGTTGTTGCACAAAAATATAATATTTACGGTATAACACTGTCTGAAGTTTTAATTGATGTACTTACCGGAGAATATGAAGTGCTTCGAGTAGATATACTGGAGGATGTCGGTCAAAGTGTCAGTCCCGAGATTGATGTTGGACAAATAGAAGGGGCTTTCATTATGGGCTTAGGATACTGGACCACAGAGAGACTAGTCTATGACAAGAAGACCGGAGAACTACTGACCGATACTTCTTGGACTTACTATGTTCCACAAGCGCGAGATATACCGCAGGACATGAGAGTTTATTTCAGAAAGAATTCTTATAGTAACCGACCCAGTTTTGGATCTAAAAGTTCGTAA
Protein
MVTMGEFLQTNMRGTVILNVMLPPLNKTYLVTTMKIMPKSQNAHAIVNAGFLYKLANNSIVTQARIVYNGISPTFVRALGTENFLIGKPLFKNETLQSALNILKKDLNATEMPPEPSPAYRQQLGLAMFYKGLLYFCPSNNINPRYLSGATFLRKARPLSRGEQNYETNAALWPLNQPIPKLESLIQCAGEAEYVDDIPSLPYEVFGAFVLSTVALGQIASIDASEALKMKGVIAFYTAKDIPGKNSFIPKEEYNTSDEEILCSGDVKYYNQPLGIIVAELQHIAIVAAKSVKVKYTNIRKPVLDISDAIKDPKRNSILVSVDATTRGHDTRQVVKGNATIYGQYHFSMEILVCVTLSTEEGLQVYPSVQNMDGVQAVISKALNLDANRIDIKVRRLGGSYGIKVTRSNQVAVSCSLVSFKLNRPCRFVLPLSTTTRAYGKRFPCIADMEAGINRSGIIQYLNFKLYEDNGYKVNEIIPSISRDVYNNCYEKSTWSFQCINTITDTAKNSWFRAPGTLEAVSFVELFMDRIAYEANLDPIELRLANLDPEHKDLREMLDTLMKESKYKERRKAVEIFNKNNRWLKKGLRFSFLKWASTIAPYFDVNISVYHVDGTVSLTHGGIEMGQGINTKAAQICAYFLKVPLEKVQVKATNTNTCPNSSITAGSFTILSIGIGVERSCKDLLQRLEPIRSKMPYATWQELIAKAFEENVDLQAHGFVNRNDVVAQKYNIYGITLSEVLIDVLTGEYEVLRVDILEDVGQSVSPEIDVGQIEGAFIMGLGYWTTERLVYDKKTGELLTDTSWTYYVPQARDIPQDMRVYFRKNSYSNRPSFGSKSS

Summary

Cofactor
FAD
Mo-molybdopterin
[2Fe-2S] cluster
EMBL
BABH01034958    BABH01034959    BABH01034960    BABH01034961    BABH01034962    BABH01034963    + More
BABH01034964    BABH01034965    NWSH01000648    PCG75032.1    BABH01034979    BABH01034980    BABH01034981    KQ459606    KPI91000.1    PCG75033.1    KQ460326    KPJ15694.1    KZ150165    PZC72655.1    KPI90999.1    ODYU01003306    SOQ41884.1    KZ150135    PZC72996.1    PZC72997.1    RSAL01000123    RVE46648.1    NWSH01007964    PCG62737.1    ODYU01000376    SOQ35055.1    PCG62736.1    KY595781    ARS46835.1    RSAL01000088    RVE48202.1    ODYU01001481    SOQ37735.1    KPI90998.1    KPJ15693.1    PCG62735.1    KPI90997.1    PZC72657.1    PZC72656.1    ODYU01000882    SOQ36316.1    ODYU01002094    SOQ39169.1    JTDY01003126    KOB70107.1    JTDY01003022    KOB70290.1    AGBW02011403    OWR46707.1    LC017755    BAR64769.1    KY595780    ARS46834.1    LC017758    BAR64772.1    KQ459674    KPJ20482.1    KQ459193    KPJ03064.1    BABH01001558    NWSH01007172    PCG63055.1    KF960794    AII21996.1    KQ461154    KPJ08620.1    KPJ03063.1    NWSH01002143    PCG69059.1    NWSH01000413    PCG76559.1    JTDY01003017    KOB70302.1    ODYU01002537    SOQ40155.1    LC017757    BAR64771.1    ODYU01001878    SOQ38698.1    LC017753    BAR64767.1    ODYU01004253    SOQ43930.1    BABH01001657    BABH01001658    BABH01001659    BABH01001660    PCG76561.1    KF960795    AII21997.1    PCG76558.1    RSAL01000229    RVE43893.1    PCG76560.1    KP899546    AKQ06145.1    RVE48204.1    BABH01001568    BABH01001569    BABH01001570    BABH01001571    BABH01001572    BABH01001573    KQ435826    KOX72014.1    AGBW02008082    OWR54176.1    KY595779    ARS46833.1    EU073423    ABW71271.1    KY595778    ARS46832.1    EU073424    ABW71272.1    KPI90909.1    ODYU01001109    SOQ36868.1    KY643683    AQY62686.1    KQ461196    KPJ06614.1    LC017752    BAR64766.1    LC017754    BAR64768.1    KC952900    AGQ43599.1    GEYN01000003    JAV02126.1    KQ979701    KYN19698.1    AGBW02010767    OWR47879.1    KZ288369    PBC26783.1    JR045677    AEY60027.1    KPI90950.1    KQ434912    KZC11368.1    KK852888    KDR14320.1    KF960796    AII21998.1    KQ982557    KYQ55015.1    GEDC01004862    JAS32436.1    KQ414670    KOC64413.1    NEVH01007404    PNF35793.1    JTDY01003130    KOB70096.1    KQ971466    EFA13012.2    GL447829    EFN85870.1    ODYU01002835    SOQ40809.1    ACPB03005165    KQ769812    OAD52839.1    CH477659    EAT37664.1    ODYU01007852    SOQ50986.1    GL441193    EFN65044.1    ACPB03021369    ACPB03021370    KQ977306    KYN03667.1    KP899547    AKQ06146.1    GEDC01022855    JAS14443.1    GEDC01024956    JAS12342.1    GBBI01004413    JAC14299.1    DS497731    EFA13013.1    ODYU01004588    SOQ44620.1   
Pfam
PF02738   Ald_Xan_dh_C2        + More
PF01315   Ald_Xan_dh_C
PF03450   CO_deh_flav_C
PF00111   Fer2
PF00941   FAD_binding_5
PF01799   Fer2_2
PF01130   CD36
PF07651   ANTH
Interpro
IPR000674   Ald_Oxase/Xan_DH_a/b        + More
IPR002888   2Fe-2S-bd       
IPR036884   2Fe-2S-bd_dom_sf       
IPR005107   CO_DH_flav_C       
IPR008274   AldOxase/xan_DH_Mopterin-bd       
IPR036318   FAD-bd_PCMH-like_sf       
IPR001041   2Fe-2S_ferredoxin-type       
IPR036010   2Fe-2S_ferredoxin-like_sf       
IPR036683   CO_DH_flav_C_dom_sf       
IPR036856   Ald_Oxase/Xan_DH_a/b_sf       
IPR006058   2Fe2S_fd_BS       
IPR016166   FAD-bd_PCMH       
IPR002346   Mopterin_DH_FAD-bd       
IPR037165   AldOxase/xan_DH_Mopterin-bd_sf       
IPR016208   Ald_Oxase/xanthine_DH       
IPR016169   FAD-bd_PCMH_sub2       
IPR012675   Beta-grasp_dom_sf       
IPR002159   CD36_fam       
IPR013809   ENTH       
IPR008942   ENTH_VHS       
IPR011417   ANTH_dom       
IPR014712   Clathrin_AP_dom2       
SUPFAM
SSF54665   SSF54665        + More
SSF54292   SSF54292       
SSF55447   SSF55447       
SSF56176   SSF56176       
SSF56003   SSF56003       
SSF47741   SSF47741       
SSF48464   SSF48464       
PDB
3BDJ     E-value=6.15579e-102,     Score=950

Ontologies

Topology

Length:
838
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.28184
Exp number, first 60 AAs:
0.19667
Total prob of N-in:
0.01030
outside
1  -  838
 
 

Population Genetic Test Statistics

Pi
275.360016
Theta
181.947967
Tajima's D
1.719141
CLR
0.231089
CSRT
0.834758262086896
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号