SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10679
Pre Gene Modal
BGIBMGA008832
Annotation
PREDICTED:_uncharacterized_protein_LOC105383034_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 2.765
 

Sequence

CDS
ATGTCGGTCGGCACGAGTTCGTCAATTCAACATGCCGCCATTGAAAAACTGCGTGGTGCAGAAAACTACTCCACGTGGAAGTTCTCCATGCGGATGCTATTAATCCATGAAGAGTTATGGGATTCCGTCATGGATAAATCGGAATTGACGGAAGCCATGAAGAAAAAGAGCGAAAAGGCATTGGCACGTATTGCATTGTCGGTGCAGCCAGCGGTCATCCCATGCATCCGCACCGCCACCAGCGCACACGAGGCGTGGAATAACCTAAGTAAGGCATACGAAGGGCGCGGCTTGTGCAGGAGGCTTGGCATACTGAGAAGTCTCTTCGGTGTCAAGTTATCGGATAGCAGTTCCATGGAAGCCTACATCAATAAAATTAAAGAGTTGGCGTATCAACTGAGTGAAATGGAATCCGCATTGGATGATGAGTTTATTGCCGTTATAATGCTAAGTGGGCTCACAGAAGATTTTGACCCCCTCATTATGGCAATTGAGAACTCAAATGTAAAACTCACCACGGAACTTGTCTCAGGAAAACTCTTAGCAGAAAACCAGAGGCGTAAGGAGAAACAAGAAGTCACTGCGTTGGTAATCAAGAAGCAACCGAGATGCTTCAAGTGCAAAAATGTGGGTCACATTTCTAAGAATTGTACCGACAAAGGAAGCTTCAAGGAGCCAGCGGACGTAGGAGGCAACAAGGGCCAAAATAAATCCAGGCATCAGGCAAGGAGCAATCCGAAGCAGAATATCCCAAAGGACAAAGCGCTCGTTGCAGCTCTGTCTGTAAAAATAAGCAGTGATGTGTGGTGCATTGACTCCGGTGCTACTAATCATATGTGCAATGATAAAAGGTACATGATTGACTTCCGACCTAATAGTGTGGATGTGAGCATCGCGAATGGTGAAATGCTACGAACAGGTGGCATTGGACATGTAAGAGTTCATATGAAAGACTGTATAAGGACAATAAGTGATGTGTATTATGTTCCTAATCTTAGTACTAACTTATTGTCAGAATTTCTCAAGAAGAATGGCATCCAACACCAGAAAACTATTGCGGATAGTCCGCAACAGAATGGTGTTGCTGAACGGGCCAATAGGACCGTCGTAGAGAAGGCACGGAGTATGCTGCGGGATGCTAGCCTGGGAATGAAATTTTGGGCTGAGGCTGTGAACACTGCCGTATACCTTAAGAACCGGAGTCCAACAAAAGCTGTCATAGGAGCTACTCCGGAGGAAAAATGGTCAAACAAAAAGAGCGTACACAGAAAACAGAGGCATAGCGCAATCACATTGGACGGTTCTGATAGCGGAGAAACGGATTATGATGCAAATGACTGCTTGGATGAAACTTATATTCCAGGGGACGATTCATTGGTTGAAGCAGAGGAGACAGATGATTCATATGAAGATTTGCCAGATTCTCCGCTGAGGGCAAGCTTCGTGAGATTAGTCGACAACCCTGATGATCTCCAGACTGCAGCCGAGGCCTTAAACGGGCCTGAATCGGACAGTTGGAGAAAGGCAATGACAGATGAGTATAATTCCTTTGTTAAGAACAAGTGTTGGACCCTGACTGAGCATGAACCCAGCCGCAAACCAGTCAAATGTAAATGGATTTTTAAAAGAAAATATGGAGCAGATGGAGAGTTACTAAAGTATAAAGCTCGTTTAGTTGCCAAGGGTTACACACAGAAGTACGGTGTTGATTATCAAGAGACTTTTTCACCAGTGGTAAGGTACTCCACAATTAGGATTTTACTTGCTTTAGCAGCTGAACATGGCCTGTCCATTGAGCACCTGGATGTCAAAACGGCGTTCCTTAATGGCGACCTCGAGGAAACTGTATACATGGAGCAGCCAGAGTTCTTTGAAAAAAAAGGAAAAGAGAACATGGTGTACAGGCTAAATAAAGCTGTGTACGGCTTAAAACAGGCATCCAAGACATGCTCTCTATGTCGATGA
Protein
MSVGTSSSIQHAAIEKLRGAENYSTWKFSMRMLLIHEELWDSVMDKSELTEAMKKKSEKALARIALSVQPAVIPCIRTATSAHEAWNNLSKAYEGRGLCRRLGILRSLFGVKLSDSSSMEAYINKIKELAYQLSEMESALDDEFIAVIMLSGLTEDFDPLIMAIENSNVKLTTELVSGKLLAENQRRKEKQEVTALVIKKQPRCFKCKNVGHISKNCTDKGSFKEPADVGGNKGQNKSRHQARSNPKQNIPKDKALVAALSVKISSDVWCIDSGATNHMCNDKRYMIDFRPNSVDVSIANGEMLRTGGIGHVRVHMKDCIRTISDVYYVPNLSTNLLSEFLKKNGIQHQKTIADSPQQNGVAERANRTVVEKARSMLRDASLGMKFWAEAVNTAVYLKNRSPTKAVIGATPEEKWSNKKSVHRKQRHSAITLDGSDSGETDYDANDCLDETYIPGDDSLVEAEETDDSYEDLPDSPLRASFVRLVDNPDDLQTAAEALNGPESDSWRKAMTDEYNSFVKNKCWTLTEHEPSRKPVKCKWIFKRKYGADGELLKYKARLVAKGYTQKYGVDYQETFSPVVRYSTIRILLALAAEHGLSIEHLDVKTAFLNGDLEETVYMEQPEFFEKKGKENMVYRLNKAVYGLKQASKTCSLCR

Summary

Pfam
PF00098   zf-CCHC        + More
PF00665   rve
PF07727   RVT_2
Interpro
IPR036875   Znf_CCHC_sf        + More
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR013103   RVT_2       
IPR039537   Retrotran_Ty1/copia-like       
IPR001584   Integrase_cat-core       
IPR036397   RNaseH_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
654
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01354
Exp number, first 60 AAs:
0.0003
Total prob of N-in:
0.00090
outside
1  -  654
 
 

Population Genetic Test Statistics

Pi
301.899826
Theta
199.448936
Tajima's D
3.005787
CLR
0.429398
CSRT
0.978501074946253
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号