SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10660
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.105
 

Sequence

CDS
ATGGACTTCGAGTCCGCGACTAGCCCTCAACCCGGAACCTCGGATGGGTTCCAAACTGTAACGCGCGGTAAAAAGCGTACTCGCGTCGTGGAGTCCCGGAGCTCCACGACGAAGCAAACCAAGTCCGCGACCGCCTCCCGACCGCAGGTAGTCGTAACGCCGGAGTCGGACTCCGCCCGCCGCGTAATCCCACCGCCGCGCCCAAAAACCGCGCCCGCGCCTAAAACAGTTGTCCCGCCCCCGCTGATACTCCAGGAGAAGTCAGCGTGGAATCGCGTATCCCAGGCCCTTCAGGCCAACAAAATTAATTATACCCATGCGCGTAACGTCGCGCATGGGATTCAGATTAAGGTCGCAACGCCGGGCGACCATAGGGCCCTCTCTGCTTACCTCCGAAAGGAGAACATAGGTTATCACACCTATGCTCTTCAGGAGGACCGCGAACTCCGCGTAGTGATACGTGGAGTCCCCAAGGAACTCGACATAGACTACGTAAAGGAGGATCTGATCGGTCAGTCCCTCCCAATAATTAGTGTGCACCGGATGCACAGCGGACGCGGCAGACAGCCGTACAATATGATTCTCGTCGCGCTAGAATCAACCCCGGAGGCAAAGAAAAGAATCTCATGTCTCAAAACGATATGCGGCCTCTCCGGGGTCACCATCGAAGCTCCCCATAAACGTGGTACTCCCGGGCAGTGCCACAGGTGCCAGCTCTATGGCCACTCAGCGCGTAATTGCCACGCGCGCCCCCGCTGCGTGAAATGCCTCGGCGATCACGCAACCACAGAATGTTCGCGTGTTAGGGAAACCGCGACGGAACCCCCAAGCTGTGTCCTATGCCTTAAGCAAGGGCACCCGGCAAACTACCGCGGATGTCCTAGGGCTCCGCGTAAACGCCTGAACCACCCAGCCCCCCGAACCGTCGACCCAAAGACTTCGGCGCCTTCAGTGCCGAAACCAGCCTTCGTACCGGCTGCGGTTCCCACCGTCTCGGCGTGGAAAAAACCGCTGCCGTATACGAAGGAGGGAACACAAAACGTACCCCAGCTCCCGCCTGCGACACGTCACGCGCCTCAGCCCCTGCTCGCACCTCGCCCCGCGCCCGCGTACCGCCCCCCGCAACCCTCAGTCGTCAACGACTTCGCGCTCGTGCGCGACTTCGTCACCGCGGTAAACTTTGACCGTCTGCGATCGTTCGCAGATGCTATCCGTAGATCTTCAAAAGAAGTCGATGTGGAGGACAGCTTCCACCGCATCAGACTGTCCTCCGAACTTAGGAATCTCTTAAGAGTTAGGAACGCGGCAATCCGGGCCTACGATCGTCTTCCCACGCATTCAAACCGGATTCGGATGCGTCGTCTACAACGCGAAGTCCACTCCCGCCTAAGTGACGCGCGTAACGATAATTGGCATAGTTATTTAGAACAACTCGCGCCCTCCCACCAAGCATACTGGCGACTAGCTAGGACTCTCAAATCCGAAACTACCGCTACTATGCCTCCCCTCGTACGCCCTTCAGGCCAACCACCGGCATTCGATGACGATGACAAGGCTGAGCTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTAGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTGACGAAGTTAGAGACGCGATCCACAACCTCCAACCTAGGAAGGCACCCGGCTCCGACGGCATCCGCAACCGCGCGCTAAAACTCTTGCCAGTCCAACTGATAGCAATGTTGGCTACAATTTTAAATGCCGCTATGACGCACTGCATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGTATACATAAGCCGGGCAAACCGACAAACGAAACTTCTAGTTACCGTCCGATTAGTCTCCTCCCGACGATAGGAAAAATTTACGAACGGCTTCTTAGGAAACGCCTCTGGGATTTTGTTACCGCGAACAAAATTCTCATAGACGAACAGTTCGGATTCCGCTCTAAACACTCGTGCGTACAACAAGTGCACCGCCTCACGGAGCACATCCTGATAGGACTAAATAGGCGTAAACAAATCCCGACCGGCGCCCTCTTCTTCGACATCGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTAATTTACAAACTGTACAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTTCTTGTCGAACCGTTCGTTTCGATATCGAGTAGAGGGAACTCGTTCTCGTCCCCGTCAACTGACTGCCGGAGTCCCGCAAGGCTCCGCGCTCTCCCCGTTATTATTTAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTAGCGCTCTTCGCCGATGACACGGCTATCTACTACTCGTGTAGGAAGATGTCGCTGCTTCATCGGCGACTCCAGATCGCAGTAGCCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATCAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAATACCACTTCGAGCATCCCACTCCCTAATAGGCGCGCAAACACCTCCGCCGTTAGCCCCGTCACTCTCTTTGGCCAGCCCATACCGTGGGCCTCGCAGGTCAAATACCTAGGCGTCACCCTCGACAGAGGGATGACATTCCGTCCCCATATTAAAACGGTACGCGACCGTGCCGCCTTCATATTAGGACGTCTCTACCCTATGCTTTGCAAGCGAAGCAAACTGTCCCTCCGTAATAAGGTAACTCTCTACAAAACTTGCATACGCCCCGTTATGACGTATGCAAGCGTAGTGTTCGCTCACGCAGCCCGCACCAACTTGAAGCCCCTTCAGGTTATTCAATCCCGATTCTGCAGGATAGCCGTCGGAGCACCATGGTTCCTGAGGAACGTGGATGTCCACGATGACCTGGAGCTTGACTCTGTCAGTAAGTATCTACAGTCGGCATCGCTGCGCCATTTTGAGAAGGCGGCACGACATGAGAACCCTCTCATCGTAGCCGCTGGAAATTACATACCCGACCCAGTAGACCGAATGGTAAACCGTCGACGTCGCCCAAAGCACGTCATTACGGATCCTCCTGATCCATTAACGGTGCTCTTAGGCACCACAAGCACCGGTCACCGTCCTCGTCGAACCCGTCGCTTGCGACGAAGGGCTCGACGAGCGAACTAA
Protein
MDFESATSPQPGTSDGFQTVTRGKKRTRVVESRSSTTKQTKSATASRPQVVVTPESDSARRVIPPPRPKTAPAPKTVVPPPLILQEKSAWNRVSQALQANKINYTHARNVAHGIQIKVATPGDHRALSAYLRKENIGYHTYALQEDRELRVVIRGVPKELDIDYVKEDLIGQSLPIISVHRMHSGRGRQPYNMILVALESTPEAKKRISCLKTICGLSGVTIEAPHKRGTPGQCHRCQLYGHSARNCHARPRCVKCLGDHATTECSRVRETATEPPSCVLCLKQGHPANYRGCPRAPRKRLNHPAPRTVDPKTSAPSVPKPAFVPAAVPTVSAWKKPLPYTKEGTQNVPQLPPATRHAPQPLLAPRPAPAYRPPQPSVVNDFALVRDFVTAVNFDRLRSFADAIRRSSKEVDVEDSFHRIRLSSELRNLLRVRNAAIRAYDRLPTHSNRIRMRRLQREVHSRLSDARNDNWHSYLEQLAPSHQAYWRLARTLKSETTATMPPLVRPSGQPPAFDDDDKAELLADALQEQCTTSTQHADPEHTELVDREVERRASLPPSDALPPITTDEVRDAIHNLQPRKAPGSDGIRNRALKLLPVQLIAMLATILNAAMTHCIFPAVWKEADVIGIHKPGKPTNETSSYRPISLLPTIGKIYERLLRKRLWDFVTANKILIDEQFGFRSKHSCVQQVHRLTEHILIGLNRRKQIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDFLSNRSFRYRVEGTRSRPRQLTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKMSLLHRRLQIAVATMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTSSIPLPNRRANTSAVSPVTLFGQPIPWASQVKYLGVTLDRGMTFRPHIKTVRDRAAFILGRLYPMLCKRSKLSLRNKVTLYKTCIRPVMTYASVVFAHAARTNLKPLQVIQSRFCRIAVGAPWFLRNVDVHDDLELDSVSKYLQSASLRHFEKAARHENPLIVAAGNYIPDPVDRMVNRRRRPKHVITDPPDPLTVLLGTTSTGHRPRRTRRLRRRARRAN

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.00312712,     Score=100

Ontologies

GO

Topology

Length:
1078
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.623199999999998
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00037
outside
1  -  1078
 
 

Population Genetic Test Statistics

Pi
0.174054
Theta
0.174643
Tajima's D
0
CLR
20.347284
CSRT
0.245187740612969
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号