SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10650
Pre Gene Modal
BGIBMGA007053
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.649
 

Sequence

CDS
ATGGATGACCATGTTCGTGGCATAGTCGGGAAATTCGGGCTAGGGACTCGTAACGAGCGAGGGCAGTTACTCCTCGACTTCTGTGCGGAAAACAATGTTTCAATCATGAACACCCACTTCCAGCATCATCCTCGAAGGTTGTATACATGGATCTCCCCTAACGGTCAACATAGGAACCAGATTGACTATGTCATGATAGGGAAACGATGGAAATCATCTGTCCTGAATGTTAAGACGAGACCAGGTGCAGATTGTGGCAGTGACCACCAACTACTTGTTGCAAAAGTTAAAATCCGTCTTAAGTCAATCAAACAGCAGAAACCTAGGAAGGTGGTGGACATATCGGGTCGAGCGCAGGAGTTGTTTGCCAATGCCATTAAGGAGCGGTTGCGTGATTTTGCCGTAGATCCCTTCGACTCTGCAAATGTTACCTGGGAACAGTTGAAACAGGTAACCTTGCAGACAGCGAGCGAAGTCGTCGGAACACAAGCAATAGAACAACCTAAATCACCTTGGATGTCCGAAGAAACATGGTCAGCTATCGTCAAAAGAAAAGCCCGAAAGGAGGATGGTCTTACGACTGACGCAGATAAGCATGAGTACAGACTGCTGCATCATGAAGTCCAAAGACTTTGCAGACGTGACAGAGATGCCTATATAAGTGCTGTCTGCGACGACATTCAAAGGGATTCTGAACGCATGCATTCTAAGGACATGTTCCGCAGAGTGAAGCTGTTGGCCAAAGAGTACAAGCTGAAAACCTGGACTATTGAGGACGACCGTGGTAACCTCATCATTAACAGGCAGGCTGCGCTGGACAGATGGAGGAGATACAGCGAACAGCTATATAGCGAAAAGGGCTGCAATGATATTGAAGAAAGGGTGGACTATAACCAACATGAGCCAGATATCCTTCTTCAAGAAGTTGAGGCAGCAATCAATAGGCTGAAGCAAAAAGCATGCGGAAGGGACAGCGTAACCGCTCTAATGTTAAAGAGCCTAGGCTCGGATGGTGCCAAGATTTTACACTCCATTTGCCAGAAAGTATGGCGTACTGGCCAGTGGCCTGAAGACTGGACGGAATCAATATTAATTCCTCTCCATAAAAAAGGCTCCACGCGCAAATGTGAGAACTACAGGACTATCTCCATAATCTCGCATGCCAGTAAAATTCTCCTCCATATTATCAATAAAAGACTGGAGAGTTTTATCAGTAGGCAAATCGCAAAAGAGCAAGCGGGTTTTGTTAAGGGTCGAGGAACCAGAGAGCAGATCTTAAACATAAGGCAGTTGATCGAAAAGGCAAGGGAGTTCAACGTCCCGATGGCTCTCTGCTTCATTGACTACGCCAAGGCTTTTGACTGCATCAACTGGAAGAAAATGTTCGACGTGATGCAAGAGATGGGAATACCGGACCACCTCGTCTCCCTTGTTCAGACTCTATATATGGATGGAATTACGAGAGTCAGAATGGACAATGAGTTTTCCCATCCATTTAAGCCCGAACGTGGAGTCAGACAGGGGTGTATTCTTTCCCCACAACTCTTCAACCTCATCGGTGAACACATTATGAGGCTCGTTCTGGAGAACTGGGAGGGGGGTATTCGTGTAGGAGGCCACCGAATTAGTAATCTTCGTTTCGCTGATGATACCACTATAATCGCTGGCACAATGACACGCACTCACGAACTGCGTGACCTGGACGTGGTGCAGGAATTTGTGTACTTGGGGTCATTAATATCCAGTGACGGTGATTGTGACAGGGAGGTGGTCAGGAGGGCCCAGATATCAAAATCAGCCGTGAAGCGATTGGAGAAGATTTGGAGAAATCGCAGCATAAACAAAAAAACTAAGATAAAGCTCATGAGAACCCTTATCTTCTCCATATTCTTGTACGCTTCTGAGACGTGGACCCTCAAGGGCCGTACCCGATCGAGAATTGACGCATTTGAAATGTGGTGTTGGCGCAAAATGTTGGGCGTATCATGGACGGAGCGCCGAACAAATGTGTCAGTTCTCGAGGAGCTAAACGTCAAGACCCGTCTATCTACAATCTGCATGCAGCGTCTCCTCAAATACTTCGGACACGTGGCCCGACAAAATCCCGAGAACTTGGAAAAATTAATAGTTGTAGGTCACGTGGAAGGAAAGAGAAGTCGAGGAAGATTGCCAACCAGGTGGACGGATATTATCAAGGAGGCCACAAACACCAGCGTCCCGGGCGCCATTAAGCAGGCCGAATGCAGGCAGCATTGGAGGAAGCTGGTGCAAAAACTGGACCAAGGTGGTCACGACCCTCAGCAATGA
Protein
MDDHVRGIVGKFGLGTRNERGQLLLDFCAENNVSIMNTHFQHHPRRLYTWISPNGQHRNQIDYVMIGKRWKSSVLNVKTRPGADCGSDHQLLVAKVKIRLKSIKQQKPRKVVDISGRAQELFANAIKERLRDFAVDPFDSANVTWEQLKQVTLQTASEVVGTQAIEQPKSPWMSEETWSAIVKRKARKEDGLTTDADKHEYRLLHHEVQRLCRRDRDAYISAVCDDIQRDSERMHSKDMFRRVKLLAKEYKLKTWTIEDDRGNLIINRQAALDRWRRYSEQLYSEKGCNDIEERVDYNQHEPDILLQEVEAAINRLKQKACGRDSVTALMLKSLGSDGAKILHSICQKVWRTGQWPEDWTESILIPLHKKGSTRKCENYRTISIISHASKILLHIINKRLESFISRQIAKEQAGFVKGRGTREQILNIRQLIEKAREFNVPMALCFIDYAKAFDCINWKKMFDVMQEMGIPDHLVSLVQTLYMDGITRVRMDNEFSHPFKPERGVRQGCILSPQLFNLIGEHIMRLVLENWEGGIRVGGHRISNLRFADDTTIIAGTMTRTHELRDLDVVQEFVYLGSLISSDGDCDREVVRRAQISKSAVKRLEKIWRNRSINKKTKIKLMRTLIFSIFLYASETWTLKGRTRSRIDAFEMWCWRKMLGVSWTERRTNVSVLEELNVKTRLSTICMQRLLKYFGHVARQNPENLEKLIVVGHVEGKRSRGRLPTRWTDIIKEATNTSVPGAIKQAECRQHWRKLVQKLDQGGHDPQQ

Summary

EMBL
FJ265559    ADI61827.1    FJ265546    ADI61814.1    GU815090    ADF18553.1    + More
FJ265548    ADI61816.1    FJ265557    ADI61825.1    FJ265553    ADI61821.1    FJ265547    ADI61815.1    FJ265560    ADI61828.1    FJ265552    ADI61820.1    KZ150203    PZC72267.1    KZ150025    PZC74827.1    NCKU01004395    RWS06003.1    BDSA01000081    GBE63537.1    LBMM01007694    KMQ89503.1    QIAP01000240    PYX61602.1    NWSH01001998    PCG69477.1    GFAH01000222    JAV48167.1    GGMR01018096    MBY30715.1    NEVH01016289    PNF26277.1    NEVH01021921    PNF19488.1    NWSH01000469    PCG76200.1    NEVH01017460    PNF24248.1    NEVH01011186    PNF32183.1    AFYH01119920    NEVH01016335    NEVH01006721    PNF25462.1    PNF37115.1    PNF37310.1    NEVH01013215    PNF29703.1    PNF37211.1    KF881087    AIJ27486.1    NEVH01003500    PNF40666.1    NEVH01015309    PNF27009.1    NEVH01013553    PNF28765.1    NEVH01013959    PNF28275.1    NEVH01017534    PNF24114.1    NEVH01012082    PNF31006.1    NEVH01002141    PNF42599.1    NEVH01020937    PNF20581.1    NEVH01023985    PNF17546.1    AAGJ04118689    AAGJ04161747    NEVH01014359    PNF27813.1    NEVH01021219    PNF19787.1    NEVH01005277    PNF39212.1    NEVH01020865    PNF20863.1    PNF27789.1    NEVH01002684    PNF41704.1    NEVH01022640    NEVH01008218    NEVH01005885    PNF18513.1    PNF34430.1    PNF38481.1    NEVH01017570    PNF23798.1    NEVH01019075    PNF22955.1    NEVH01003750    PNF40091.1    NEVH01018372    NEVH01014371    NEVH01011208    NEVH01002697    NEVH01002552    PNF23678.1    PNF27673.1    PNF31697.1    PNF41592.1    PNF42118.1    NEVH01013275    PNF29009.1    NEVH01023960    NEVH01010501    PNF17732.1    PNF32290.1    NEVH01007402    PNF35815.1    NEVH01019971    PNF22037.1    NEVH01025135    PNF15828.1    NEVH01014358    PNF27914.1    NEVH01019064    PNF23230.1    AHAT01017643    AHAT01008485    NEVH01017443    PNF24485.1    GU815089    ADF18552.1    NEVH01005896    PNF38208.1    NEVH01027104    PNF13657.1    NEVH01017540    PNF24056.1    NEVH01020851    NEVH01013954    NEVH01006574    NEVH01001358    NEVH01001354    PNF21237.1    PNF28332.1    PNF37782.1    PNF42792.1    PNF42884.1    NEVH01026085    PNF14968.1    NEVH01020940    PNF20478.1    NEVH01023953    PNF17877.1    NEVH01011205    PNF31711.1    NEVH01027067    PNF13944.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR002138   Pept_C14_p10       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
768
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.15493
Exp number, first 60 AAs:
0.00081
Total prob of N-in:
0.00055
outside
1  -  768
 
 

Population Genetic Test Statistics

Pi
238.489037
Theta
35.162072
Tajima's D
2.218445
CLR
0.167729
CSRT
0.914754262286886
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号