SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10648  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA014430
Annotation
endonuclease_and_reverse_transcriptase-like_protein_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.099 Nuclear   Reliability : 1.346 PlasmaMembrane   Reliability : 1.642
 

Sequence

CDS
ATGTTAAACTTCTATCGGCGTTTCATTCCAAACGCTGCTGCGGCTCAAGCACCTCTCCATGGCATGCTGTCGGGATCAAAGGTCAAAGGATCACACCCACTTACCTGGACGCCGGAACTTCTCGAAGCTTTCAACACCTGTAAAGCAAGTATAGCTAGAAGTACTCTCCTCGCTCACCCAGCCATGAACGCGCCGCTCGCTCTCGTGACAGATGCCTCAAATTCTGCCTTGGGCGCGGTGCTACAGCAGTCAGTGGAAGGACAATGGCAACCACTCGCCTTCTTCTCGAAGAAACTTAAAAAAGCTCAGCAGCTGTACAGCGCCTATGACCGAGAGTTGCTCGCTATATACGAGGGCGTTAAACATTTCCGTTTTATGGTTGAAGGCAGACACTTCGTCATTTATACGGATCATAAACCCATCACATACACCTTTTATCAGAATAGCCAGAAGTGCTCGCCCAGACAGTTTAACCACCTCGATTTCATGTCTCAATTCACCACAGACATAAGGTTTATATCGCGGAAGGATAATATACCTGCGGACACTTTGACGCGCATTGAAGCCGTATCATCGCCACCGGACTTACAACAGCTTGCTCGTTCACAGGAGAATGACAACGAGCTCCAGGAACTCCTCTCAAAGCGCTCATCTTCTTCGTTAAAGATGGAACAGATACCTATACCTGGAACGAACGTTACTTTATACTGTGACGTCACTCTGTCGAGGCCTCGTCCTTTTATAACAAAGGAGTTGAGTCGGCAGGTCTTCAACTCAATTCATACCATGAGTCACCCTGGTACGAAAGCGACAACCAAGATGGTAATGAGTAGGTTTATTTGGCCTTCAGCTCGATGGGATTGTCGCACTTGGACTCGGGCCTGCGAAGCCTGTCAGAAATCGAAGATCCACAGGCATATTTCATCTCCGCTGGGTGATTTCCAGTTACCGCAATCACGTTTCAGCCACGTACACATTGATTTGATTGGACCGCTACCGTCTTCGAATGACTACAAGTACTGTCTTACAGCAGTAGACAGGTTCACAAGATGGCCAGAGCTAATCGAGAAGGGTCGCGAATACAACGTTCCATTCATCATGTGTTTCATCGACTACAGCAAGGCTTTTGATTGTGTCAACTGGAGTTCCTTGTGGAAGGTATTGAATGTTCCTGGTGTACCCAATCATCTGATAGTGCTGGTACAGAGCCTGTATATCTACAGTCAGGGAGTTGTCAGAATCGATGAAGCTGTGTCCCAACCGTTCTGTTTTGGAAAAGGTGTCCGGCAAGGTTGCATACTGTCACCTATACTTTTTGATGCATATGGAGAGTACATCTTGCGGCAGACTTGTGAAGATTGGTCGGGAGATGTGCGCATTGGTGGAGCTCATATTACAAATCTCCGATATGCCGATGACACGACCCTGCTAGCTGCAGACGAATCTGAAATGTCTTCTTCAGCAAAATGGAACCTACAGAAGATCTGGAAGAATAGAGGGATAGGCCTGAAAACTAAAACCAGACTGGTGCGGACTCTTGTTTTCTCTATCTTCTTGTATGGAGCTGAGACATGGACGTTGAAAGCAGCAGACCGAATGCGCATCGATACTTTCGAAATGTGGTGTTGGAGACGCATGCTAAGAATTCCGTGGACAGCCTTCCGGACTAACGTGTCGATATTGAAGCAACTGGGCATCAAAATCAGACTGTCTACTGTATGGAAAGTTGAAGGCAACAGATCTAGAGGCCGCAGCCATACTCGTTGGTCCGATCAGATCCGCACCGCTTTGGACAGTACAGTGTACAGCGCGCTGCATGACGCCGTGGACAGAGGGAAAGTGGAAAAAGATCCTAAGATTGAAGCTCATGGTATAAAAGACACCGAAGTGATGACTGACAACATTCTACTCGAGGGAACCTTTAAACTGGTAGTAGCCATGAAGGTCTTCGCAGCAGTACTGATGGCGTTGGCGGCCGTGGTCGTGGCAGAAGAGCCCATCGAACTCGACTACCACAACAAGATCGGTATCCCCCGGGCCGAGAGTCTTAGACGCGCCGAGGAAGCCGCTGACTTCGACGGTACCAGGATTGTGGGTGGTTCTGCCGCCAACGCTGGTGCTCACCCCCATCTTGTAAACGATCAAAACTTGTGTCTGGGGCGAGTCTCCGAATGGGGTGAATTGAACTTGGTTCAATTCAACCCGATAAAGACACAAGTTTGCGCGTTCACTGCGAAGAAGGACCCCTTTGTCATGGCGCCGCAATTCCAAGGAGTATCCCTGCAACCTTCCGAGAGTATCGGGATACTTGGGGTCGACATTTCGAGCGATGTCCAGTTTCGGAGTCATTTGGAAGGCAAAGCCAAGTTGGCGTCCAAAATGCTGGGAGTCCTCAACAGAGCGAAGCGGTTCTTAACGCCTGGACAAAGACTTTTGCTTTATAAAGCACAAGTCCGGCCTCGCATGGAGTGCTGCTCCCATCTCTGGGCCGGGGCTCCCAAATACCAGCTTCTTCCATTTGACTCCATACAGAGGAGGGCCGTTCGGATTGTCGATAATCCCATTCTCTCGGATCGTTTGGAGCCTCTGGGTCTGCGGAGGGACTTCGGTTCCCTCTGTATTTTGTACCGTATGTTCCATGGGGAGTGCTCTGAGGAATTGTTCGAGATGATACCAGCATCTCGTTTTTACCATCGCACCGCCCGCCACCGGAGTAGAGTTCATCCATACTACCTGGAGCCACTGCGGTCATCCACAGTTGGACTTGTGATCGCACTGACGAATGGCAGAACTTCCGTCTGCGGAGCTTCCTTACTGACCAACACCCGCTCCGTGACCGCGGCTCACTGCTGGAGGACCAGGAACGCCCAGGGTCGTCAGATCACCCTCGCTTTTGGCACAGCTAACATCTTCTCCGGAGGCACCAGGGTCACCACCTCCAATGTCCAGATGCACGGCAGCTACAACATGAACAACCTCAACAACGACGTCGCCGTCATCAACCACAACCACGTTGGCTTCAACAACAACATCCAGCGCATCAACCTAGCCAGTGGAAGCAACAACTTTGCTGGTACTTGGGCCTGGGCTGCCGGCTTCGGGAGGACCTCCGATGCTGCTTCGGGAGCCAACAACCAACAAAAACGCCAAGTCAGCCTCCAGGTCATTACCAACGCCGTCTGCGCCCGCACGTTTGGAAACACTGTGATCATTGGCTCCACTCTCTGTGCTGACGGCTCTAACGGTCGCAGCGTCTGCAGCGGAGACTCCGGCGGCCCTCTCACCATCGGCAGCGGCGGAGGCCGTCAGCTGGCGGCTCCCCATTCCACATTTAATGTGGATTTCAGCAATGTCAGGGGCCTACATAGCAACCTTGACGCCGTACACCACCACCTTGAGACGGCGCAGCCTGCCCTGCTTTTTTTAACGGAGACGCAGATATCTGCTCCGGATGATACCTCATACCTTGAATACCCCGGCTACGTATTGGAGCACAACTTCCTGCGTAAAGCCGGGGTGTGCGTATTCGTCCGGGCTGATGTCTGTTGTCGCCGTCTTCGGGGCCTCGAACAACGGGACCTGTCCCTCTTGTGGCTGCGCGTAGATCACGGGGGCCGTAGCCGAATCTACGCGTGCCTGTACAGGTCCCACAGCAGTGATGCAGGTTCAGCTCTATTTGAGCATGTGCAAGAGGGGACTAACCGCGTGCTTGAGCAGTACCCATCTGCGGAGGTGGTGGTTCTTGGAGACTTTAACGCTCACCACCAAGAGTGGTTGGGGTCCAGAACCACTGACCTCCCGGGTCGGACTGCCTACGATTTCGCCTTGGCCTACGGCTTCTCCCAGCTGGTGACACAGCCCACCCGTGTCCCAGATATCGAGGGGCACGAGCCTTCTTTGTTGGACCTTCTGCTGACCACAGATCCGGCCGGATACAGTGTGGTGGTCGACGCTCCGCTTGGATCGTCTGATCACTGCCTTATTCGTGCTGCCGTTCCACTCTCTCGTCCTGATCGTCGAACGACGACCGGGTATCGAAGAGTTTGGCGGTATATGTCAGCAGATTGGGATGGATTGCGTGAATTTTACGCATCCTACCCATGGGGGCGGTTCTGCTTTTCCTCTGCTGATCCTGACGTCTGTGCGGACCGTCTTAAAGACGTGGTGCTCCAGGGGATGGAATTGTTTATTCCCTCCTCTGAAGTGCCCGTTGGGGGTCGCAGCAGACCCTGGTATAACAATGCCAGCAGGGATGCTGCACACCTCAAGCGGTCCGCATACGTGGCATGGGATAATGCCAGGAGACGTCAGGACCCTAACATCTCAGAGGAAAGGCGGAAATATAACGCCGCTTCCAGGTCCTACAAGAAGGTTATTGCCAAGGCGAAGTCGGAGCACGTTGCTAGAATTGGCGAGCGACTGAAGAGCTATCCCTCTGGGAGCCGTGCTTTTTGGTCGCTCGCTAAAGCTGCAGAAGGAAACTTTTGCAGGTCTAGTCTCCCACCACTACGCAAGTCCGATGACAGTCTGGCCCATAGTGCGAAAGAGAAGGCTGACCTTCTGGTCAAACTCTTCGCCTCGAACTCGACTGTGGACGACGGGGGTGCCACACCACCGAACATCCTCCGGTGTGATAGTTCCCTGCCCGAGATCTGCTTTACACAGTGTGCAGTCAGGCGGGAACTCCGACTCCTGGACGTCCATAAGTCGAGCGGGCCAGACGGCATCCCTGCAGTGGTTCTGAAAACGTGCGCCCCTGAGCTGACGCCTGCGCTAACGCGTTTGTATCGCCTCTCTTATTGCACTAACAGGGTTCCGTCTTCATGGAAGACTGCCCACGTCCACCCTATCCCCAAGAAGGGTGACCGGTCGGACCCATCGAGCTATAGGCCTATCGCGATAACTTCCTTGCTTTCCAAGGTGATGGAGCGAATAATTAATATACAACTCCTGAAGTATCTGGAGGATCGCCAGCTGATCAGTGACCGACAGTACGGTTTCCGTCACGGTCGCTCAGCTGGCGATCTTCTTGTATACCTTACTCACAGGTGGGCTGAAGCCTTGGAAAGCAAGGGCGAGGCTCTTGCTGTGAGCCTTGATATCGCGAAGGCCTTCGACAGGGTCTGGCATAGGGCACTTCTATCGAAGTTACCATCTTACGGAATCCCCGAGGGTCTCTGCAAGTGGATCGCTAGCTTTTTGGATGGGCGGAGCATCACGGTCGTTGTAGACGGTGACTGTTCTGATACCATGACCATTAACGCTGGCGTTCCACAAGGTTCGGTGCTCTCCCCCACGCTTTTCATCCTGTATATCAATGACATGCTGTCTATTGATGGCATGCATTGCTATGCAGATGACAGCACGGGGGATGCGCGATATATCGGCCATCAGAGTCTCTCTCGGAGCGTGGTGCAAGAGAGACGATCAAAACTTGTGTCTGAAGTGGAGAACTCTCTGGGGCGAGTCTCCGAATGGGGTGAATTGAACTTGGTTCAATTCAACCCGATAAAGACACAAGTTTGCGCGTTCACTGCGAAGAAGGACCCCTTTGTCATGGCGCCGCAATTCCAAGGAGTATCCCTGCAACCTTCCGAGAGTATCGGGATACTTGGGGTCGACATTTCGAGCGATGTCCAGTTTCGGAGTCATTTGGAAGGCAAAGCCAAGTTGGCGTCCAAAATGCTGGGAGTCCTCAACAGAGCGAAGCGGTACTTCACGCCTGGACAAAGACTTTTGCTTTATAAAGCACAAGTCCGGCCTCGCATGGAGTACTGCTCCCATCTCTGGGCTGGGGCTCCCAAATACCAGCTTCTTCCATTTGACTCCATACAGAGGAGGGCCGTTCGGATTGTCGATAATCCCATTCTCTCGGATCGTTTGGAGCCTCTGGGTCTGCGGAGGGACTTCGGTTCCCTCTGTATTTTGTACCGTATGTTCCATGGGGAGTGCTCTGAGGAATTGTTCGAGATGATACCAGCATCTCGTTTTTACCATCGCACCGCCCGCCACCGGAGTAGAGTTCATCCATACTACCTGGAGCCACTGCGGTCATCCACAGTGCGTTTCCAGAGATCTTTTTTGCCACGTACCATCCGGCTATGGAATGAGCTCCCCTCCACGGTGTTTCCCGAGCGCTATGACATGTCCTTCTTCAAACGAGGCTTGTGGAGAGTATTAAGCGGTAGGCAGCGGCTTGGCTCTGCCCCTGGCATTGCTGAAGTCCATGGGCGACGGTAA
Protein
MLNFYRRFIPNAAAAQAPLHGMLSGSKVKGSHPLTWTPELLEAFNTCKASIARSTLLAHPAMNAPLALVTDASNSALGAVLQQSVEGQWQPLAFFSKKLKKAQQLYSAYDRELLAIYEGVKHFRFMVEGRHFVIYTDHKPITYTFYQNSQKCSPRQFNHLDFMSQFTTDIRFISRKDNIPADTLTRIEAVSSPPDLQQLARSQENDNELQELLSKRSSSSLKMEQIPIPGTNVTLYCDVTLSRPRPFITKELSRQVFNSIHTMSHPGTKATTKMVMSRFIWPSARWDCRTWTRACEACQKSKIHRHISSPLGDFQLPQSRFSHVHIDLIGPLPSSNDYKYCLTAVDRFTRWPELIEKGREYNVPFIMCFIDYSKAFDCVNWSSLWKVLNVPGVPNHLIVLVQSLYIYSQGVVRIDEAVSQPFCFGKGVRQGCILSPILFDAYGEYILRQTCEDWSGDVRIGGAHITNLRYADDTTLLAADESEMSSSAKWNLQKIWKNRGIGLKTKTRLVRTLVFSIFLYGAETWTLKAADRMRIDTFEMWCWRRMLRIPWTAFRTNVSILKQLGIKIRLSTVWKVEGNRSRGRSHTRWSDQIRTALDSTVYSALHDAVDRGKVEKDPKIEAHGIKDTEVMTDNILLEGTFKLVVAMKVFAAVLMALAAVVVAEEPIELDYHNKIGIPRAESLRRAEEAADFDGTRIVGGSAANAGAHPHLVNDQNLCLGRVSEWGELNLVQFNPIKTQVCAFTAKKDPFVMAPQFQGVSLQPSESIGILGVDISSDVQFRSHLEGKAKLASKMLGVLNRAKRFLTPGQRLLLYKAQVRPRMECCSHLWAGAPKYQLLPFDSIQRRAVRIVDNPILSDRLEPLGLRRDFGSLCILYRMFHGECSEELFEMIPASRFYHRTARHRSRVHPYYLEPLRSSTVGLVIALTNGRTSVCGASLLTNTRSVTAAHCWRTRNAQGRQITLAFGTANIFSGGTRVTTSNVQMHGSYNMNNLNNDVAVINHNHVGFNNNIQRINLASGSNNFAGTWAWAAGFGRTSDAASGANNQQKRQVSLQVITNAVCARTFGNTVIIGSTLCADGSNGRSVCSGDSGGPLTIGSGGGRQLAAPHSTFNVDFSNVRGLHSNLDAVHHHLETAQPALLFLTETQISAPDDTSYLEYPGYVLEHNFLRKAGVCVFVRADVCCRRLRGLEQRDLSLLWLRVDHGGRSRIYACLYRSHSSDAGSALFEHVQEGTNRVLEQYPSAEVVVLGDFNAHHQEWLGSRTTDLPGRTAYDFALAYGFSQLVTQPTRVPDIEGHEPSLLDLLLTTDPAGYSVVVDAPLGSSDHCLIRAAVPLSRPDRRTTTGYRRVWRYMSADWDGLREFYASYPWGRFCFSSADPDVCADRLKDVVLQGMELFIPSSEVPVGGRSRPWYNNASRDAAHLKRSAYVAWDNARRRQDPNISEERRKYNAASRSYKKVIAKAKSEHVARIGERLKSYPSGSRAFWSLAKAAEGNFCRSSLPPLRKSDDSLAHSAKEKADLLVKLFASNSTVDDGGATPPNILRCDSSLPEICFTQCAVRRELRLLDVHKSSGPDGIPAVVLKTCAPELTPALTRLYRLSYCTNRVPSSWKTAHVHPIPKKGDRSDPSSYRPIAITSLLSKVMERIINIQLLKYLEDRQLISDRQYGFRHGRSAGDLLVYLTHRWAEALESKGEALAVSLDIAKAFDRVWHRALLSKLPSYGIPEGLCKWIASFLDGRSITVVVDGDCSDTMTINAGVPQGSVLSPTLFILYINDMLSIDGMHCYADDSTGDARYIGHQSLSRSVVQERRSKLVSEVENSLGRVSEWGELNLVQFNPIKTQVCAFTAKKDPFVMAPQFQGVSLQPSESIGILGVDISSDVQFRSHLEGKAKLASKMLGVLNRAKRYFTPGQRLLLYKAQVRPRMEYCSHLWAGAPKYQLLPFDSIQRRAVRIVDNPILSDRLEPLGLRRDFGSLCILYRMFHGECSEELFEMIPASRFYHRTARHRSRVHPYYLEPLRSSTVRFQRSFLPRTIRLWNELPSTVFPERYDMSFFKRGLWRVLSGRQRLGSAPGIAEVHGRR

Summary

Uniprot
ProteinModelPortal
PDB
4OL8     E-value=2.41888e-18,     Score=233

Ontologies

Topology

Length:
2079
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
3.00147000000001
Exp number, first 60 AAs:
0.00184
Total prob of N-in:
0.00156
outside
1  -  2079
 
 

Population Genetic Test Statistics

Pi
197.050967
Theta
159.114514
Tajima's D
1.1073
CLR
0.000588
CSRT
0.689515524223789
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28556443 IVGGSAANAGAHPHLAGLVIALTNGR 100.00 6e-04
28556443 IVGGSAANAGAHPHLAGLVIALTNGR 100.00 6e-04
28556443 INLASGSNNFAGTWAWAAGFGR 100.00 6e-04
28556443 IVGGSAANAGAHPHLAGLVIALTNGR 100.00 6e-04
28556443 IVGGSAANAGAHPHLAGLVIALTNGR 100.00 6e-04
28556443 EEAIELDYHNK 100.00 6e-04
28556443 IVGGSAANAGAHPHLAGLVIALTNGR 100.00 6e-04
28556443 EEPIELDYHIK 100.00 6e-04
28556443 AEEAADFDGTR 100.00 6e-04
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号