SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10646
Annotation
PREDICTED:_uncharacterized_protein_LOC105842998_isoform_X1_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.255
 

Sequence

CDS
ATGGCTGCCATTACGGAGCGCCTTGGCCGGGCTCCGTCAGTGCGACTCTACGGATCCGGTTTTCGATTCCTGCCGTCATCCGTCGAGGAGTGGAGGGTGGTCCAGGCGTACCTGTCGGGGGCCTCCGCAGCTGACAGTGCCATTAAATGGTACTGTTATGCGCTGACGGAGGGCATCCCCACTAAGGTAGTGATCCGGGGCCTCCCTGCCGACACGGATGCGGCAGTGATCACGCAGGCTGTAAAAGAGCTTGGATTCCCGGCGCGTTACGCCCGGTGTATCGAGGCCAGGAGAGGGAGGCCGGGCTGCATATTTTACGTAGCTCTCGACCACCTCTCCAAGGTCGACCTCGCCCGCCTGTACGCAGTCAATGAACTGCTGTACTTGCTGGTGGTGTCAGTTGAGGATTGGCGTTCTGGAAGAGGGCCTGCGCAGTGTCATCGCTGCCAGGCCTTCGGCCATGCCTCCACCAACTGCCACCGAGCGGTCGGCTGCGTACGATGTGCAGGAGAGCACGTGGTAGCGGACTGCCCGAGGCCGAGGGAGGGCCCATTTACCTGTGCCAACTGCGGCAAGGACCACGCAGCCGTCGACAGACGGTGCGCGATCTATCGCAGAAAGGTTGTGCGCCGCCTCTACGCGGGGGTGGTGCGATCGATGGCCCTGTACGGTGCACCTGTATCGGCTGAGTCGCGCAACCGGGCCACTATGGCTCGGTTCCTGCGCCGGCCGCAGCGCACCGTTGCCATCAGGGTCATCCGCGGATATCGCACCGTCTCCTTCGAGGCGGCGTGTGTGTTGGCGGGGACGCCGCCATGTGAGCTGGAGGCGAAGTCGCTTGCTGCCGACTATCGGTGGCGCAGCGAGCTTCGTGTTCGGGGCGTGGCGCGTCTCCCCGAAAGTGAGCTGCGGGCGCGGAAGGCCCATTCTCGGCGGTCCGTGCTCGAGTCGTGGTCGAGGCGATTGGCCAACCCCACAAAAATTGGTACCCGCCTGCGGGATTCGAACACCGGTGCATCGTTTCGTCTGGTGCAGGTGCTGACCGGGCACGGATGCTTCGGGAAGTACCTGCGCCGGATAGGGGCTGAGCCGACGACGAGGTGTCACCATTGTGGACACGACCTGGACACGGCGGAGCATACGCTCGCTGTCTGCCCCGCTTGGGAGGGGCAGCGCCGTGTCCTGGTCGCAAAGATAGGACTTGACTTGTCGCTGCCTGGCGTCGTGGCGTCGATGCTTGGCAGCGATGAGTCATGGAAGGCTATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGTGTGAGGCAAAGCTCTCCTCACTACGCAGAAACCCGCCGCCGCCGAGCAGGGGGTCGGGACCGGGGTCGTATCCGTGACCTGGCCCCCTAA
Protein
MAAITERLGRAPSVRLYGSGFRFLPSSVEEWRVVQAYLSGASAADSAIKWYCYALTEGIPTKVVIRGLPADTDAAVITQAVKELGFPARYARCIEARRGRPGCIFYVALDHLSKVDLARLYAVNELLYLLVVSVEDWRSGRGPAQCHRCQAFGHASTNCHRAVGCVRCAGEHVVADCPRPREGPFTCANCGKDHAAVDRRCAIYRRKVVRRLYAGVVRSMALYGAPVSAESRNRATMARFLRRPQRTVAIRVIRGYRTVSFEAACVLAGTPPCELEAKSLAADYRWRSELRVRGVARLPESELRARKAHSRRSVLESWSRRLANPTKIGTRLRDSNTGASFRLVQVLTGHGCFGKYLRRIGAEPTTRCHHCGHDLDTAEHTLAVCPAWEGQRRVLVAKIGLDLSLPGVVASMLGSDESWKAMLDFCECTISQKEAAGRVRQSSPHYAETRRRRAGGRDRGRIRDLAP

Summary

Uniprot
ProteinModelPortal

Ontologies

Topology

Length:
467
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.32583
Exp number, first 60 AAs:
0.0016
Total prob of N-in:
0.02078
outside
1  -  467
 
 

Population Genetic Test Statistics

Pi
226.144521
Theta
47.14739
Tajima's D
1.444707
CLR
18.013026
CSRT
0.774361281935903
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号