SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10628
Annotation
PREDICTED:_uncharacterized_protein_LOC106720812_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 1.666 PlasmaMembrane   Reliability : 1.213
 

Sequence

CDS
ATGCCGACAAACCCTGCGACTAGTACTGGTTTGCAAGTTAATATTATACAACCTAGTACTTCCCAACATGTAGACAGCATTGCTCCGAGTGAGACGTCTAAGTCAAAATCATCACGCTCGTCATCCACAATTAAGGCTCAAAAGGCCGCCGTAGAGGCCCTCGCCCTGCGCCGACGTCTTGAGCACGAGCAGGAGCTGGCTGAACGTGAGAGGCAACGTGAAAGTCGACTGGCAGCACTCCGTCAGCAGGTAGAGGAGGGCGAACTGAAGGCCGAACTTGCCGCTCTCGACGCGGAAGCCGCGGCAAGTCACAGCAGTCGCAGTGGTTCTGCCAGGGTAAGCGTAGAAAGAACAGAAAGATGGGTACAAAGTTTAGGACAGCCAGTTTGCGTTGGCGAAAATACAGTTAATAGAGGCATCCCCGCAGTAGGGCGAGAGCAAGTAGTTGTTCCGCCTCCCGGCCACCAGGCACCTCTGCCGGCCACTGGGTCAACTGCATCCCCTGTTAACCGTTTTGTTCATCAGAAACAACTTTTAAACGTCACTAAAGCGTCCGAGGCGGCCGTACTTACGCGACCGCTCATTTCCACGGAGGTTGATCAGAGTAGTCTGCTTCAGGCTGTTGCTGACACTGCAGCTGCGGCCAAGGCGCTTGCTACTTCGCACCGTCATAAACATAAGATCGAATTGTTTCCTTTCGACGGAGACGCCTTAACATGGCTACATTTCAAACGTATTTTTGATTTAACCAAAAACAATTTTTCAAATATTGAAAATATTAGTCGGTTACAAAATGCACTTCGCGGCGCGGCCCGAGATGCAGTCGCGTCACTGTTGCTGGCTACAGACAACCCGAACGACATTATAAGAGCTCTGGAGGAGAACTTCGCTCGCCCGGAAATTATAGTATTTAAGGAAGTCTCCGCTCTTAAAAATCTACCACGTTTGGGAAATGACCTGAAAGAGTTAATTACGATAACGAATAAGGTACGTAATTCTATATGTTCTTTTAAAATACTGAATCAAATTGAGTACTTGCATTCTCCAGAACTATTTCACGCCGTCTTAGGAAAATTAAACCCGGTTACTAAAGTAAGATGGACGGACTTTGCTATGCAAGATACTACAGGGCGTCCTAAATTAGAAATTATGTCCGATTTTTTGAGGCGCGAGTTAGATCAACTTATTCGGTTCGGTTTATCACCGGAATCTTGCTCGATCCAACATTCATCACAAAACACTCAACTAAACAAACCGTATAAACGGGAAAATATTCACATAGTTACACACTCTAAACTAAATTCTAAGGCGGCGTCTACACAAAAGCTTGAATGCGCGTTTTGCAAAAAAGATCATAATATTAAGTCATGTTCTGAGTTCAAAGCCTTATCTGTTGATGAAAGGTGGGTCTGGCTGCGTGAGGTAAAAGCGTGTTATAAATGTCTTAGGCGTAGTTCACATCAGTGGAAAACATGTAAAGTTAACCCTTGTGGTGTTGATGGGTGTCTAATACGTCATCACCCGTTAATGCATGGTAAAGAACCTGCCTCTTCTGTCAATACTGTGTTCGACACGCAATCCACCGAAAATGATCATACGACTAAGCACCACGAACCTGCATCTGTCGAAAAGGTAATAGTTTCTACCATTTCTACAGGTGTTCAAGAACCCAGCTCCATCTTAACTCTGTGCCCACGTGTATTTCTGAAAATCTTACCCGTTACTGTCTCTGGTCCCTCAGGAAGTTGCAATGTTTACGCACTTCTCGATGACGGTAGCACTGCTACGCTCATTGACTCAAGTATTGCTACTCAAATCGGTGCGACAGGGCCTCACCAGAAAATAACGGTTAATGGTATAGGCGGTCTCAGTAGAAACGCTACGATATCGTATGTAGATTTTCACATTAAGGGTAGGCACACACGAGACACATTTTTAGTGAAAAATGCGAGAGCTATGGAGTCTTTGTCTCTGCGTCCTCAAACAATTAGGCAGGAAACTATTGCTTCTTTCGCACATTTAGCGAATTTACCTTGCAACATAACTTACGAAGATGCTACACCAACAGTTTTAATTGGTGCAGAGCATTGGCATTTGTCAATCAGCAGCGAGGTACGGTGTGGTGGTAAGAATGAACCCGTTGCCTGTTTAACTGCCTTAGGCTGGGTGCTGTATGGAATCGCCTCCAGTAAAACTAAATTAGTGGAGTTTGTTAATCACGGTGTGTGTATCGAACCTTCCGATGAGGAGAAATTAGACTCTCTTATTAGGGAACAATACAAAATTGATTCGTTAGGTATTTCTAAAAAAGAAACTCTACATTCTAAGTCAGATAAACGTGCAGTCGAAATTTTAGAAAAAACTGCTAGACGCCTCCCCACTTCTGGTCGATTTGAGGTGGGTATGCCGTGGCGTGACGATATACAACGCATTCCCGACAGCTACCCTCAAGCCATGTCACGATTTTTAAGTCTAGAAAGGCGCATGGCTAAAGATGCTGACTTTGCAAAAGCATATGACGTGTTCATTTCAAACATGATCGCTAAAGGCTATGCAGAAGAATGTGCTCCTGAGTCATACTACGCCAACCACATTAAAGATAAACAATCTTCTTTTATGAGGCTCTATTTACCCCATTTTGGCGTGTATCACCTTCAGAAACGTAAGCTTCGTGTAGTTCACGACGCCGCAGCCACGAATGCGGGCGTCAGCCTAAACTCTTTGCTGCTACCTGGTCCAGACCTGCTTCAGTCCTTGTTAGGTATTTTACTTCGGTTTCGCGAGGGCCGTATTGCTCTCACTGCTGATATCCGGGAAATGTTCCCTCAGGTAAGGATCAGAGAGCAAGATAGGGACGCCCTCCGGTTTCTCTGGAGGTCAAGCAGAGACCAACCTATAAAGGAGTTTAGGATGACAGCCATCATTTTCGGTGCGTGCTGCAGTCCATTTATAGCGCAATTTATTAAAAATAAAAACGCTCGTGAGCACGAAAGTTTATTTCCTAAAGCAGCTCATGCTATTTTGTACAATCATTATATGGACGATTATATTGACTCTCTCGATGACATTCAAGAGGCAGCACAACTGGCGGCAGATATTGTTGCCGTTCACAATGATGCCTACTTCGAGATGCGGGGCTGGATTTCCAACGATCCATCAGCGCTAAAATTTATTCCTGCTGATCTTAGGGCCACTCAACCGTCGTTGGAAATCAACCTTGGCAGCTGCTCTGCAAACAATATTAGAGCGTTGGGAGTATTGTGGAATCCCATAACAGATAATTTAGGGTTCCGCTCAGGCTTAGGTGAAACATTTCCAAACCCTCTCACAAAACGCAAAGTTCTTTGTCACCTCATGCGTGTGTACGACCCGTTAGGCTTATTAGCTCCAATAGTTGTTAAGGGTCGAATTTTATTTCAACAAACGTGGAGGTCTAATGTCGACTGGGACACCGAGTTCCAACCCACGGAAGCATTAAGATGGTCTGATTGGTTTCAGGAGCTGTCAAAAGTAACTTCTTTGGAAATTCCGCGTTGGTATTCTAACTCTAAAAACTCTGAACCAACTCAGAGGGAGTTACACGTTTTTGCTGATGCAAGTGAGCTCGCGTACGCATGTGTCGCTTATTGGCGCCTTTTATACTCAGACGGCAGCATCGAGCTTTCTCTCATCTCTAGTAAGGCAAGAGTTACACCCTTGAAACCTATCTCTATCCCACGTTTAGAGCTCCAGGCCGCTTTAATAGCTTCTCGTCTCGCGGTCACCATTAAGGACAGTCATAGAAAACAACCGGCACATACTTTCTTTTGGACCGATTCTATGACAGTCCTTCAGTGGTTACATCCTGACGACCCGACAACACTCACACCATTTCATTTCTTAATCGGTTCTTCGTCCGTGCAGACCTTACCTACTGCCTTGAACGATCACGATTTGGTCAGCCGTTCCGAATGGAGGAAAGCATTGAGGCTAGCAGATCATTTTTGGTCGCGTTGGATGCGCGAGGTTCTCCCGACCCTACAACCACGTGAGCAGTTAAGAGGCAACCGCAGTTCAACAGCTTTTCAAGAGGGTGACGTAGTAATTATTGCTGACTTTAACTTGCCCCGCGGAATATGGCCACGAGGACGTGTTGCGAAAGTGTACCCTGGGAAAGATGGCGTGATAAGGGTAGTGGACGTTGCAACAGCAGGGGGAATGCTACGCCGACCCGTACGAAAGCTGCTCGAGACCAGAGCCTTCAATAGCAGTGGAGTAATCGTCACGAATGATTCATGCAACCCCGAGGAGTGTGTCATCACGGCGCGGCCTGAACGTGGAACCAGCAAGTTTACTTGTGAGGTCTCCAGTGAGGGGCCGCGGTTTGCCGTGGATAGACAATCGGCCAACATGACGGTAGCTGTTCTACCAGAATACGATCCACTGATCACGGGTCTCCCAACCATGGTCCAGGCAGGAGAACAGGCTGTGGTCAACTGCACTTCTGATTACTCGCTACCAGCGGCCACAATAGATTGGTTTGTGGATTCAGAACCTCAAGAAGTTAGTAATAATAATATTTTATGA
Protein
MPTNPATSTGLQVNIIQPSTSQHVDSIAPSETSKSKSSRSSSTIKAQKAAVEALALRRRLEHEQELAERERQRESRLAALRQQVEEGELKAELAALDAEAAASHSSRSGSARVSVERTERWVQSLGQPVCVGENTVNRGIPAVGREQVVVPPPGHQAPLPATGSTASPVNRFVHQKQLLNVTKASEAAVLTRPLISTEVDQSSLLQAVADTAAAAKALATSHRHKHKIELFPFDGDALTWLHFKRIFDLTKNNFSNIENISRLQNALRGAARDAVASLLLATDNPNDIIRALEENFARPEIIVFKEVSALKNLPRLGNDLKELITITNKVRNSICSFKILNQIEYLHSPELFHAVLGKLNPVTKVRWTDFAMQDTTGRPKLEIMSDFLRRELDQLIRFGLSPESCSIQHSSQNTQLNKPYKRENIHIVTHSKLNSKAASTQKLECAFCKKDHNIKSCSEFKALSVDERWVWLREVKACYKCLRRSSHQWKTCKVNPCGVDGCLIRHHPLMHGKEPASSVNTVFDTQSTENDHTTKHHEPASVEKVIVSTISTGVQEPSSILTLCPRVFLKILPVTVSGPSGSCNVYALLDDGSTATLIDSSIATQIGATGPHQKITVNGIGGLSRNATISYVDFHIKGRHTRDTFLVKNARAMESLSLRPQTIRQETIASFAHLANLPCNITYEDATPTVLIGAEHWHLSISSEVRCGGKNEPVACLTALGWVLYGIASSKTKLVEFVNHGVCIEPSDEEKLDSLIREQYKIDSLGISKKETLHSKSDKRAVEILEKTARRLPTSGRFEVGMPWRDDIQRIPDSYPQAMSRFLSLERRMAKDADFAKAYDVFISNMIAKGYAEECAPESYYANHIKDKQSSFMRLYLPHFGVYHLQKRKLRVVHDAAATNAGVSLNSLLLPGPDLLQSLLGILLRFREGRIALTADIREMFPQVRIREQDRDALRFLWRSSRDQPIKEFRMTAIIFGACCSPFIAQFIKNKNAREHESLFPKAAHAILYNHYMDDYIDSLDDIQEAAQLAADIVAVHNDAYFEMRGWISNDPSALKFIPADLRATQPSLEINLGSCSANNIRALGVLWNPITDNLGFRSGLGETFPNPLTKRKVLCHLMRVYDPLGLLAPIVVKGRILFQQTWRSNVDWDTEFQPTEALRWSDWFQELSKVTSLEIPRWYSNSKNSEPTQRELHVFADASELAYACVAYWRLLYSDGSIELSLISSKARVTPLKPISIPRLELQAALIASRLAVTIKDSHRKQPAHTFFWTDSMTVLQWLHPDDPTTLTPFHFLIGSSSVQTLPTALNDHDLVSRSEWRKALRLADHFWSRWMREVLPTLQPREQLRGNRSSTAFQEGDVVIIADFNLPRGIWPRGRVAKVYPGKDGVIRVVDVATAGGMLRRPVRKLLETRAFNSSGVIVTNDSCNPEECVITARPERGTSKFTCEVSSEGPRFAVDRQSANMTVAVLPEYDPLITGLPTMVQAGEQAVVNCTSDYSLPAATIDWFVDSEPQEVSNNNIL

Summary

EMBL
RSAL01000375    RVE42106.1    NWSH01005440    PCG64209.1    AF530470    AAQ09229.1    + More
GEZM01052588    GEZM01052587    GEZM01052586    JAV74402.1    LNIX01000019    OXA44855.1    JXUM01136032    KQ568367    KXJ69026.1    LNIX01000015    OXA46575.1    LNIX01000003    OXA57597.1    LNIX01000004    OXA55241.1    LNIX01000007    OXA52015.1    JXUM01111221    KQ565482    KXJ70922.1    JXUM01127084    KQ567147    KXJ69602.1    LNIX01000039    OXA39294.1    GEHC01000872    JAV46773.1    GGFL01001682    MBW65860.1    GEHC01000947    JAV46698.1    GAMC01017930    JAB88625.1    GGFL01001842    MBW66020.1    LN877231    CTR11689.1    GEHC01000945    JAV46700.1    GEHC01000955    JAV46690.1    JXUM01034199    KQ561015    KXJ80028.1    GGFL01005193    MBW69371.1    GGFJ01000402    MBW49543.1    GGFJ01000401    MBW49542.1    JYDJ01000015    KRX49522.1    AB110069    BAD01589.1    BAD01590.1    GGFL01001727    MBW65905.1    JXUM01005879    KQ560203    KXJ83865.1    OXA55408.1    D83207    BAA57030.1    GGFJ01000935    MBW50076.1    GGFJ01000432    MBW49573.1    GGFJ01000306    MBW49447.1    GGFJ01000487    MBW49628.1    GGFJ01000471    MBW49612.1    GGFJ01000470    MBW49611.1    KL367480    KFD71819.1    ADMH02001934    ETN60411.1    KL367585    KFD62883.1    JYDJ01000512    KRX34809.1    JYDP01000296    KRZ01365.1    JYDQ01000499    KRY07301.1    JYDO01000040    KRZ75306.1    KRZ75294.1    JYDK01000180    KRX73317.1    JYDI01000209    KRY48378.1    GEHC01000921    JAV46724.1    JYDW01000285    KRZ49986.1    JYDN01000258    KRX52286.1    JYDH01000025    KRY38464.1    JYDL01000006    KRX26626.1    KL367527    KFD66131.1    KL367482    KFD71500.1    JYDR01000106    KRY68661.1    JYDT01000008    KRY92224.1    JYDS01000555    KRZ02797.1    JYDV01000007    KRZ44161.1    JYDV01000070    KRZ36622.1    JYDU01000375    KRX86446.1    JYDV01000004    KRZ44960.1   
Pfam
PF05380   Peptidase_A17        + More
PF00665   rve
PF18701   DUF5641
PF03564   DUF1759
PF01565   FAD_binding_4
PF17921   Integrase_H2C2
PF09129   Chol_subst-bind
PF00628   PHD
PF00078   RVT_1
PF05585   DUF1758
Interpro
IPR040676   DUF5641        + More
IPR005312   DUF1759       
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR006094   Oxid_FAD_bind_N       
IPR016166   FAD-bd_PCMH       
IPR016164   FAD-linked_Oxase-like_C       
IPR041588   Integrase_H2C2       
IPR016170   Cytok_DH_C_sf       
IPR015213   Cholesterol_OX_subst-bd       
IPR036318   FAD-bd_PCMH-like_sf       
IPR016169   FAD-bd_PCMH_sub2       
IPR016167   FAD-bd_PCMH_sub1       
IPR011011   Znf_FYVE_PHD       
IPR013083   Znf_RING/FYVE/PHD       
IPR001965   Znf_PHD       
IPR019787   Znf_PHD-finger       
IPR019786   Zinc_finger_PHD-type_CS       
IPR001841   Znf_RING       
IPR000477   RT_dom       
IPR008737   Peptidase_asp_put       
IPR002999   Tudor       
IPR000253   FHA_dom       
IPR000048   IQ_motif_EF-hand-BS       
IPR001969   Aspartic_peptidase_AS       
IPR036875   Znf_CCHC_sf       
IPR021109   Peptidase_aspartic_dom_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF56176   SSF56176       
SSF55103   SSF55103       
SSF57903   SSF57903       
SSF57756   SSF57756       

Ontologies

Topology

Length:
1521
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00813999999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1521
 
 

Population Genetic Test Statistics

Pi
289.016765
Theta
157.663995
Tajima's D
2.638047
CLR
0.809037
CSRT
0.954752262386881
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号