SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10621
Pre Gene Modal
BGIBMGA003944
Annotation
Cytochrome_P450_9e2_[Papilio_xuthus]
Location in the cell
Cytoplasmic   Reliability : 2.412
 

Sequence

CDS
ATGATTATCATTATATGGACATTAGCTATAGGTTTGGCTTTCTTACTGTACCTGAAGCAGATATATTGCTACTTCAGCAAGCATGAAATCAAGAGCATAACCCCGCTTCCGATACTGGGCAACATGGGCAAGATTGTCTTCAAGATTAACCATTTTGTTGATGATATTTCTCAATTGTACAACAAATTTCCAGAAGAAAGATTCGTTGGTAGATATGAGTTTGTAAATCCGGTGATCTACATCAGAGACATTGAGATCGTAAAGAGAATCACAATTAAAGACTTTGAACATTTCCTGGATCATCGCACGATCGTCAATGAGGAAACCGATCCCATTTTCGGAAGGAATCTGTTTTCTTTGAAAGGCCAGGAATGGAAAGATATGCGATCCACTTTATCGCCAGCCTTCACCAGCTCCAAGATGAAGCTTATGATGCCCTTAATAGTCGAAGTTGGAGAGCAGATGATCAACGCGTTAAAAAAGAACATTAAAAACTCTGGTGTCGGATACGTGGACATAGACACTAAAGACCTGACCACTAGATACGCCAACGATGTGATCGCCTCCTGCGCCTTCGGTCTGAAGGTCGACTCCCTCACCGAAGAGAACAACCAATTCTACGCGATGGGGAAAGCCGCTTCGAATTTCAGTTTCAAACAGATCCTACTCTTGTTGGGATTTATCTCATTTCCTAAGATGATGAAGATGACGAAATTCACGCTGTTTTCGGAAGAAACGTCCGGATTCTTTAAAGAGCTGATAATGGGTACCATGAAAGACAGAGAAATGCGGAAAATCATCAGACCAGACATGATCCATCTACTCATGGAAGCTAAGAAAGGAAAATTAGTCCACGATGATAAATCCAGCAAAGACACAGATGCCGGATTCGCCACGGTAGAAGAATCTGCTGTTGGCAAGAAACAAATCGATAGAGTCTGGACTGATGACGACATCATCGCTCAAGCAGTTCTTTTCTTCGTTGCTGGTTTTGAAACCGTTTCATCGGCAATGACGTTCCTCCTTCACGAATTGGCTCTCAACCCTGAAGTACAAGACAAATTGGTTGAAGAAATCAAGGAGAACAAGGAGAGGAACAATGGAAAATTTGACTACAACTCCATACAGAATATGGTGTATCTGGATATGGTTGTTTCAGAACTCCTAAGGCTGTGGCCGCCAGGTGTCTCCATGGATAGAATCTGCGTTCAAGACTACAACTTGGGGAAACCAAATGACAAGGCCAAAAGAGACTTCATACTTCGCAAAGGTACGGGTGTAGCTATTCCCGTATGGGCTTTCCACCGAAACCCGGAATTCTTCCCGGACCCCCTGAAATTCGATCCCGAAAGGTTCTCAGAGGAGAACAAACACAACATCAAGCCTTTCGCGTATCTACCATTTGGAGTGGGACCTAGGAATTGTATAGGTTCTAGGTTCGCTTTATGCGAAGTCAAAGTGATGGCATACCAGCTACTCCAGCATATGGAGATATCTCCGTGCGAGAAGACGTGTATCCCCTCGAAGCTCAGCAAGGAAACCTTCAACCTTCGTCTTGAAGGTGGTAAAATGATCATCATCATATGGACATTAGTGATAGGTTTGGCTCTCTTACTGTACCTGAAGCAGACATATTCCTACTTCAGCAAGCATGAAATCAAGAGCGTAACTCCGCTTCCGATACTGGGCAACATGGGCAAGATCGTCTTTAAATTTAACCATTTAGTAGATGACATTTCGCAATTGTACAATAATTTTCCAGAAGAAAGATTCGTTGGTAGATACGAGTTTGTAAATCCGGTGATCTACATCAGAGACATTGAGATCGTAAAGAGAATCACAATTAAAGACTTTGAACATTTCCTGGATCATCGCACGATCGTCAATGAGGATTCCGATCCGATGTTTGGAAGGAATCTGTTTTCATTGAAAGGCCAGGAATGGAAAGATATGCGATCCACTTTATCACCAGCCTTCACTAGTTCCAAGATGAAGCTTATGATGCCCTTAATAGTCGAAGTGGGAGAGCAGATGATCAACGCCATAAAAGAGAATATTAAAAACTCTGGTGTCGGATACGTGGACATAGACACTAAAGACCTGACCACTAGATACGCCAACGATGTGATCGCGTCCTGCGCCTTCGGTCTGAAGGTCGACTCACTCACCGAGGAGAACAACAGATTCTACGCGATGGGGAAAGCCGCTACGAATTTCAGTTTCAAACAGATCCTAATGTTGTTGGGATTTATTTCATTTCCTAAGTTGATGAAGATGACGAAATTCAGACTGTTTTCGGAAGAAACGTCCGGATTCTTTAAGGAGCTGATAATGGGCACCATGAAGGACAGGGAAATGCGGAAAATCATCAGACCAGACATGATACACTTACTCATGGAAGCTAAGAAAGGAAAATTAGTTCACGACAATAAATCAAGCAAAGACACAGATGCCGGATTCGCCACGGTAGAAGAATCTGCTGTTGGCAAAAAACAAATCGATAGAGTCTGGACTGATGACGACATCATCGCTCAAGCAGTTCTTTTCTTCATTGCTGGTTTTGAGACCGTTTCATCGGCAATGACGTTCCTCCTTCACGAATTAGCTCTCAACCCTGAGGTACAAGAAAAGCTGGTTGAAGAAATCAAGGAGAACAAGGAGAGGAACAATGGGAAATTTGACTATAACTCCATACAGAATATGGCGTATTTGGATATGGTTGTTTCAGAACTCCTAAGGCTGTGGCCGCCAGCTGTCTCCATGGATAGAATCTGCGTTCAAGACTACAACTTGGGGAAACCAAATGACAAGGCCAAAAGAGACTTCATACTTCGCAAAGGTACGGGTGTAGCTATTCCCGTATGGGCTTTTCACCGAAACCCGGAATTCTTCCCGGACCCCCAGAAATTCGATCCCGAAAGGTTCTCAGAGGAGAACAAACACAACATCAAGCCTTTCACGTATCTACCCTTTGGTGTGGGACCTAGGAACTGTATAGGTTCCAGGTTTGCTTTATGCGAAGTCAAAGTGATGGCATACCAGCTACTCCAGCATATGGAGATATCTCCGTGCGAGAAGACGTGCATCCCCTCGAAGCTCAGCAAGGAGATCTTCAACCTTCGTCTTGAAGGTGGTCATTGGGTCAGGCTAAAGATTAGAGATTGA
Protein
MIIIIWTLAIGLAFLLYLKQIYCYFSKHEIKSITPLPILGNMGKIVFKINHFVDDISQLYNKFPEERFVGRYEFVNPVIYIRDIEIVKRITIKDFEHFLDHRTIVNEETDPIFGRNLFSLKGQEWKDMRSTLSPAFTSSKMKLMMPLIVEVGEQMINALKKNIKNSGVGYVDIDTKDLTTRYANDVIASCAFGLKVDSLTEENNQFYAMGKAASNFSFKQILLLLGFISFPKMMKMTKFTLFSEETSGFFKELIMGTMKDREMRKIIRPDMIHLLMEAKKGKLVHDDKSSKDTDAGFATVEESAVGKKQIDRVWTDDDIIAQAVLFFVAGFETVSSAMTFLLHELALNPEVQDKLVEEIKENKERNNGKFDYNSIQNMVYLDMVVSELLRLWPPGVSMDRICVQDYNLGKPNDKAKRDFILRKGTGVAIPVWAFHRNPEFFPDPLKFDPERFSEENKHNIKPFAYLPFGVGPRNCIGSRFALCEVKVMAYQLLQHMEISPCEKTCIPSKLSKETFNLRLEGGKMIIIIWTLVIGLALLLYLKQTYSYFSKHEIKSVTPLPILGNMGKIVFKFNHLVDDISQLYNNFPEERFVGRYEFVNPVIYIRDIEIVKRITIKDFEHFLDHRTIVNEDSDPMFGRNLFSLKGQEWKDMRSTLSPAFTSSKMKLMMPLIVEVGEQMINAIKENIKNSGVGYVDIDTKDLTTRYANDVIASCAFGLKVDSLTEENNRFYAMGKAATNFSFKQILMLLGFISFPKLMKMTKFRLFSEETSGFFKELIMGTMKDREMRKIIRPDMIHLLMEAKKGKLVHDNKSSKDTDAGFATVEESAVGKKQIDRVWTDDDIIAQAVLFFIAGFETVSSAMTFLLHELALNPEVQEKLVEEIKENKERNNGKFDYNSIQNMAYLDMVVSELLRLWPPAVSMDRICVQDYNLGKPNDKAKRDFILRKGTGVAIPVWAFHRNPEFFPDPQKFDPERFSEENKHNIKPFTYLPFGVGPRNCIGSRFALCEVKVMAYQLLQHMEISPCEKTCIPSKLSKEIFNLRLEGGHWVRLKIRD

Summary

Similarity
Belongs to the cytochrome P450 family.
Pfam
PF00067   p450
Interpro
IPR036396   Cyt_P450_sf        + More
IPR002401   Cyt_P450_E_grp-I       
IPR017972   Cyt_P450_CS       
IPR001128   Cyt_P450       
IPR002403   Cyt_P450_E_grp-IV       
SUPFAM
SSF48264   SSF48264       
Gene 3D
PDB
6MA7     E-value=2.77703e-67,     Score=652

Ontologies

Topology

Length:
1054
Number of predicted TMHs:
3
Exp number of AAs in TMHs:
67.25804
Exp number, first 60 AAs:
20.85668
Total prob of N-in:
0.63632
POSSIBLE N-term signal
sequence
inside
1  -  1
TMhelix
2  -  24
outside
25  -  523
TMhelix
524  -  541
inside
542  -  734
TMhelix
735  -  754
outside
755  -  1054
 
 

Population Genetic Test Statistics

Pi
209.27108
Theta
173.970703
Tajima's D
0.936119
CLR
0.280102
CSRT
0.644467776611169
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号