SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10620  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA003945
Annotation
cytochrome_P450_9a20_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 2.05 PlasmaMembrane   Reliability : 1.502
 

Sequence

CDS
ATGATTCTCCTCATTTGGGCCGTCGTGCTCATTGCCGCCTTCGTGCTGTTTTACAAACAAGCCTATTCTTTGTTCAGCAAGCACGGAGTGAAGGGCTTCACTCCGCTGCCTTTCTTTGGCAACATGGGGCGTATTGTAATAAAAATGGATCATTTCTCGGACCATATACAAAGTTTATACGATTCATTCCCAGAGGAAAGGTTCGTCGGAAGATACGAATTTCTAAACCCAATGGTTATAATTCGTGACATTGAGTTACTGAAGAAAATCACGGTTAAGGACTTCGAGCATTTCCTGGACCATCGGACTATCATCAACAAGGACACCGACCCGTTCTTCGGAAGGAGCTTGTTCTTCTTGAGAGATCAAGACTGGAAAGACATGCGCTCAACGCTTTCGCCGGCGTTCACCAGTTCCAAAATGAAGCTCATGATGCCCTTCATCGTTGAAGTGGGAGAACAGATGAATAAAGCGCTAAAGCAGAGGATACAAGAAGCAGGGGTTGGCTATGTGGACATCGACTCCAAAGACCTGACCACTAGATACGCCAACGATGTGATCGCGTCCTGCGCCTTCGGTCTGAAGGTCGACTCCATCACCGAGGAGAACAACCAGTTCTACGCGATGGGGAAAGCCGCTTCCACTTTCAACTTCAGGCAGCTTCTAATTTTCTTTGGTCTCGCATCTGTCCCGAAGCTTGTGAAGATTCTACGCATTACGCTGTTTCAAAAAGAAATCAAAACCTTCTTCAGGGAGCTGATCTTGGGTACCATGAAGAACAGGGAAGCACAAAACATTATCAGACCTGACATGATCCATCTACTCATGGAAGCTAAGAAAGGCAAGTTGAGGCACGATGAGAAATCCACAAAAGACAGCGACGCTGGCTTTGCTACCGTGGAAGAGTCCTCAGTCGGCAAAAAGGATATTAACCGAGTGTGGACAGACGATGACTTGGTCGCCCAAGCGGTTCTGTTTTTCGTCGCCGGCTTCGAAACAGTATCGTCAGCGATGACATTCCTGCTTCACGAGTTGGCTTTGAACCCTGAAGTGCAGGAGAAGCTGGTGGAAGAAATCCGAGAAAACGAGAAAAACAACAACGGAAAATTCGACTACAACTCCATTCAGAACATGGTGTATTTAGATATGGTGGTGTCAGAGGTCTTAAGATTGTGGCCACCTGTTATTGCCTTAGATAGAATGTGCGTTAAAGACTACAACTTGGGTAAACCAAATGACAAAAGCAAAGAAGATTTTATTATACGCAAAGATGTGGCGGTGGGTATACCAGTATGGGGCTTACATCGAGATCCCGAATTCTTCCCGAACCCCCTGAAATTCGATCCCGAAAGGTTCTCAGAGGAGAACAAACACAACATCAAACCCTTCAGTTACATGCCATTTGGTCTGGGACCTAGGAATTGTATAGGTTCAAGGTTCGCTTTGTGCGAAGTCAAGGTGATGACTTACCAACTCCTCCAGCACATGGAGATATCTCCGTGCGAAAAGACCTGCATTCCCTCGAAACTCAGCAAGGAGACTTTCAACCTTCGCCTTGAAGGCGGTCATTGGATCAGGCTGAAGATTAGAAATTGA
Protein
MILLIWAVVLIAAFVLFYKQAYSLFSKHGVKGFTPLPFFGNMGRIVIKMDHFSDHIQSLYDSFPEERFVGRYEFLNPMVIIRDIELLKKITVKDFEHFLDHRTIINKDTDPFFGRSLFFLRDQDWKDMRSTLSPAFTSSKMKLMMPFIVEVGEQMNKALKQRIQEAGVGYVDIDSKDLTTRYANDVIASCAFGLKVDSITEENNQFYAMGKAASTFNFRQLLIFFGLASVPKLVKILRITLFQKEIKTFFRELILGTMKNREAQNIIRPDMIHLLMEAKKGKLRHDEKSTKDSDAGFATVEESSVGKKDINRVWTDDDLVAQAVLFFVAGFETVSSAMTFLLHELALNPEVQEKLVEEIRENEKNNNGKFDYNSIQNMVYLDMVVSEVLRLWPPVIALDRMCVKDYNLGKPNDKSKEDFIIRKDVAVGIPVWGLHRDPEFFPNPLKFDPERFSEENKHNIKPFSYMPFGLGPRNCIGSRFALCEVKVMTYQLLQHMEISPCEKTCIPSKLSKETFNLRLEGGHWIRLKIRN

Summary

Similarity
Belongs to the cytochrome P450 family.
EMBL
BABH01036637    BABH01036638    EF421989    ABO07439.1    AB498807    BAI47532.1    + More
AK289297    BAM73824.1    AK289298    BAM73825.1    AK289299    BAM73826.1    FJ378716    ACJ05915.1    DQ473438    ABF14737.1    BABH01036639    BABH01036640    AK289300    BAM73827.1    EF542811    ABQ18318.1    EF535808    ABQ08710.1    EF415298    ABN71369.1    EF488994    ABP02071.1    FJ265741    ACJ04711.1    AK289302    BAM73829.1    EF535807    ABQ08709.1    AY390260    AAR26518.1    FN421128    CAZ65619.1    KM016753    AID54905.1    DQ003275    AAY21809.1    AY753201    AAV28704.1    KZ149989    PZC75618.1    FJ416332    ACJ37388.1    EU541247    ACB30272.1    MG793355    AYA28074.1    KM016752    AID54904.1    KY436738    ARI68318.1    GCVX01000068    JAI18162.1    KR676343    ALJ30298.1    EU541248    ACB30273.2    DQ788839    ABH09252.1    EU327673    ABY47595.1    JX486677    AGI65181.1    PZC75619.1    KP001132    AJN91177.1    KX443437    ASO98012.1    NWSH01001758    PCG70237.1    AY371318    AAQ73544.1    PCG70235.1    KF701145    AHW57315.1    MH001162    AYW35335.1    KY348420    ATP15901.1    KY348419    ATP15900.1    KX443436    ASO98011.1    AB381883    BAG71410.1    MG793354    AYA28073.1    AF525031    AAP80766.1    GQ915323    ACZ97417.2    RSAL01000054    RVE50006.1    KM016750    AID54902.1    EU327674    ABY47596.1    PZC75615.1    FJ227150    ACI43222.1    KR095603    AKS48891.1    GQ465040    ACV88722.1    DQ788840    ABH09253.1    KQ459144    KPJ03681.1    AY487948    AAR37015.1    RVE50007.1    KF701146    AHW57316.1    KJ671577    AID55429.1    GCVX01000063    JAI18167.1    KQ460779    KPJ12393.1    KPJ03682.1    KY436739    ARI68319.1    KPJ03683.1    EF535804    ABQ08706.1    EF535806    ABQ08708.2    BABH01036652    BABH01036653    EF491004    AK343209    ABP65279.1    BAM73893.1    AB500115    BAI49180.1    EF535805    ABQ08707.1    MF684345    ASX93979.1    KY348418    ATP15899.1    GQ915313    ACZ97407.2    KY212055    ARA91619.1    MG793356    AYA28075.1    JTDY01003828    KOB68945.1    KPJ12394.1    KJ671578    AID55430.1    AK289301    BAM73828.1    MG793353    AYA28072.1    KX443440    ASO98015.1    KM016755    AID54907.1    KX443439    ASO98014.1    AGBW02009651    OWR50238.1    AF172279    AAD51036.1    PZC75617.1    DQ256408    ABB69055.1    HQ340240    KX443438    ADP55210.1    ASO98013.1    NWSH01001322    PCG71702.1    PCG70236.1    KM016751    AID54903.1    PCG71703.1    PCG71704.1    PZC75616.1    KC832920    AHF45921.1    KJ671579    AID55431.1    KR095604    AKS48892.1    KY212054    ARA91618.1   
Pfam
PF00067   p450
Interpro
IPR002401   Cyt_P450_E_grp-I        + More
IPR017972   Cyt_P450_CS       
IPR001128   Cyt_P450       
IPR036396   Cyt_P450_sf       
IPR002403   Cyt_P450_E_grp-IV       
SUPFAM
SSF48264   SSF48264       
Gene 3D
PDB
6MA7     E-value=7.2895e-71,     Score=680

Ontologies

Topology

Length:
531
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
25.39055
Exp number, first 60 AAs:
21.82008
Total prob of N-in:
0.93192
POSSIBLE N-term signal
sequence
inside
1  -  1
TMhelix
2  -  24
outside
25  -  531
 
 

Population Genetic Test Statistics

Pi
199.855508
Theta
176.83155
Tajima's D
0.911777
CLR
0.16289
CSRT
0.630518474076296
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
26280517 DRVCFADAGIQVIK 100.00 5e-05
26280517 VDPVTGQFIIK 100.00 1e-04
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号