SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10589
Pre Gene Modal
BGIBMGA003915
Annotation
PREDICTED:_LOW_QUALITY_PROTEIN:_monocarboxylate_transporter_14-like_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 4.676
 

Sequence

CDS
ATGGACACGGAACGTACATATGCAAATGGAGTCGCCGGTAATGAGAAGTATCTCAAGTACGAGCATAAAGTTCCGTCTGAAGAGGAGAAGACTACGTCTCCTTTATTAGAGAAGGACAATATAGAGTTTATTGATGGTGTAGATTTGAAGAAAGATGAGGGAACTCAAGATTCAGATAGAAAAGATGACGGAAATAACTTGACGGTTGGTTACTATAAAGACGGGAAAGAAGATGATGCGACATCAACTAATGAAGGTGTAAAGTTCTTTGGGCTAGGAGATGCAGATAGTATATGTTCTAGTGGACCACCGCCGGAGTCAACTCCGCAAATACCAGATGGCGGTTGGGGCTGGGTGGTTGTGGCTGCTTCATTTCTAGTAGCGACAGTAGCAGACGGCCTGGCATTTTCTTACGGGCTGATAAATGACAAGTTCGTCCTTTACTTCGAGACCAGCGAAGCGAAAACTTCGCTTATCGGAAGTTTGTTTATATCCGTTCCATTGATCGCTGGGCCAATTATGAGTGCTTTAGTCGACAGATACGGATGCAAGAATATGACTATAGTTGGCGGGGTTGCGTCTACAATCGGATTCGTTGCTGCATCATTCAGCAATTCCGTTGAAGTCTTATATGTTACTTATGGTATAATGGCTGGATTAGGTATGGGACTATTGTATGTTACAGCTGTCGTATCAATAGCGTTTTGGTTTGAAAAGCGCCGTAACTTAGCCGTCGGGCTCGGCTCGTGCGGAGTTGGCTTTGGAACATTTATTTACTCTCCCTTGACGACCTACTTACTTGATGAATACGGTTGGAGAGGTGCCTTACTACTACTCGCTGGCACGGTACTAAACGTGTGCGTGTGTGGTATGCTCATGAGGGACCCTGAATGGCTGATTCTGGAACAAAAAAAGCAAAGACAGTTGAGTAAGGCAAAGAGAGCTTCCAGTTCTATGTCGATCTCGGCTAGATCTGCAAAGTCTGGTGGAGCGGAGTCCATGTACCCTGGAGTCGAGGAAATTAAGACAATGATAAAGAGTGGTGAGACACCGGAATATATCCTAACGGCATTAGTCGCGTCGATTGCCGAAGCGGAAAGCTTGGAGGCTGCTACAAAAGCTAATGCGGATCTTTCCAACCATAAAGTTAGCTCAGTGATAAATTTACCTACGTTTTTGAAGCAAAGCGAAAAGGTACCAGCAGAAGTATTAGACCAGCTTATATCAAACAAGCGACTTTATAACATAGTATTACAGAATTATCCATCATTACTTGCACTAAGGAGTAATTCCGAACAGAAACTACCCACAGAACCGCCCCCGTCCAAAGCGAAACCAGTGAAAATGTCCATGAAGCTGAAACTCAGTAAGAAAGAGAAGAAAGACTTTGCATCTAAGCTGGACGTTGTGAAGGAGAAGTTACTGCAACCGATACCAGAAAACAAGGTCATAATACCGAAAGCTGAACGGCAGGCTTGGTTCTCGAGACAGATCCAAACCGATCATCATTATTTCAGAGAGATAAGGGTGCACAGGAATTCGATAATGCATCGCGGGGCAATGATGAACATTGCCAAGTACAAACTCCGTGCGTCGTCTTGTCCAGATATTTATAGAAATTCTATGTGGTCCGTTGAAGACCACGAGGAAAAGACATGGGGACGACGACTAATAGACACGATCAACAAAACATTTGATTTCAACATGTTCACGGAGTTCCATTTCCTAATGATGAACTTATCCACGCTGGTGCTGTTCATATGGTTCATAGTACCTTACTTCTACATATCCAGTTTCATGCAGATGCGGGGCTACTCCGAAGTAGACGGCTCTTGGTTACTGAGCACTTTTGGCATTGCTACCATAATTGGAATAGTGGGCCTCGGTTGGATGGGCGATCTGCCCTGGGTGAACGTGACCAAGACTTACGCGATATGCCTCGTATTCTGCGGCATATCGATAGTAATGTTCCCGGTACTGATACGAGTATTGGATCCGGCATCGCCGGCCAGTTTCTACGTTCTAGCCATCAACGCGGCGATTTTTGGATTGATGTTTTCCAGTTCATATTCTTACACGCCCAGTATATTGGTGGAGCTGATTGCGCTTGAAAGGTTTACTATGGCGTATGGCCTGGTGCTACTCAGTCAGGGCGTTGGCCATCTGATTGGTCCCCCTATAGCTGGAGCTCTCAAAGATTCGACCGGCCAATGGGACGCGGCGTTCTACTTGGCTGGTATATGGGTGATCGTTTCCGGTGTCCTTGTTGGCGTCATACCTTACACCCAGAACTTCAGGATGTGCGGCAACGCGCCCCTGGCCAAGGACGCGGCCGGCGAGCCTGACCCTGGAATCAAAATTATTATAGCACATTAA
Protein
MDTERTYANGVAGNEKYLKYEHKVPSEEEKTTSPLLEKDNIEFIDGVDLKKDEGTQDSDRKDDGNNLTVGYYKDGKEDDATSTNEGVKFFGLGDADSICSSGPPPESTPQIPDGGWGWVVVAASFLVATVADGLAFSYGLINDKFVLYFETSEAKTSLIGSLFISVPLIAGPIMSALVDRYGCKNMTIVGGVASTIGFVAASFSNSVEVLYVTYGIMAGLGMGLLYVTAVVSIAFWFEKRRNLAVGLGSCGVGFGTFIYSPLTTYLLDEYGWRGALLLLAGTVLNVCVCGMLMRDPEWLILEQKKQRQLSKAKRASSSMSISARSAKSGGAESMYPGVEEIKTMIKSGETPEYILTALVASIAEAESLEAATKANADLSNHKVSSVINLPTFLKQSEKVPAEVLDQLISNKRLYNIVLQNYPSLLALRSNSEQKLPTEPPPSKAKPVKMSMKLKLSKKEKKDFASKLDVVKEKLLQPIPENKVIIPKAERQAWFSRQIQTDHHYFREIRVHRNSIMHRGAMMNIAKYKLRASSCPDIYRNSMWSVEDHEEKTWGRRLIDTINKTFDFNMFTEFHFLMMNLSTLVLFIWFIVPYFYISSFMQMRGYSEVDGSWLLSTFGIATIIGIVGLGWMGDLPWVNVTKTYAICLVFCGISIVMFPVLIRVLDPASPASFYVLAINAAIFGLMFSSSYSYTPSILVELIALERFTMAYGLVLLSQGVGHLIGPPIAGALKDSTGQWDAAFYLAGIWVIVSGVLVGVIPYTQNFRMCGNAPLAKDAAGEPDPGIKIIIAH

Summary

EMBL
BABH01037649    KZ149921    PZC77732.1    NWSH01007033    PCG63126.1    ODYU01000260    + More
SOQ34727.1    RSAL01000304    RVE42716.1    KQ459603    KPI93154.1    KQ460124    KPJ17668.1    AGBW02014130    OWR42229.1    KQ459435    KPJ01099.1    JTDY01005603    KOB66842.1    KQ458981    KPJ04472.1    NWSH01000554    PCG75685.1    KZ150013    PZC75044.1    KQ460882    KPJ11474.1    ODYU01004928    SOQ45305.1    BABH01031609    RSAL01000317    RVE42585.1    BABH01031610    AGBW02008415    OWR53453.1    GL771849    EFZ09427.1    KQ435732    KOX77337.1    GL888062    EGI68511.1    GECU01028486    GECU01022863    GECU01016348    GECU01008024    JAS79220.1    JAS84843.1    JAS91358.1    JAS99682.1    KQ976595    KYM79626.1    KQ978820    KYN28133.1    KQ982365    KYQ57127.1    KQ981189    KYN45223.1    NEVH01009422    PNF33023.1    GEBQ01017028    GEBQ01016920    GEBQ01012615    GEBQ01001956    JAT22949.1    JAT23057.1    JAT27362.1    JAT38021.1    GECZ01022618    GECZ01008634    JAS47151.1    JAS61135.1    GL444372    EFN60961.1    KZ288212    PBC32804.1    KQ779356    OAD51997.1    NNAY01001665    OXU23277.1    GEDC01021494    JAS15804.1    GEDC01013652    JAS23646.1    DS235115    EEB12167.1    GECZ01021235    JAS48534.1    QOIP01000010    RLU17786.1    KK107167    EZA56497.1    JTDY01003280    KOB69810.1    PYGN01000790    PSN40793.1    LBMM01005754    KMQ91230.1    GL448543    EFN84342.1    GEZM01099141    JAV53466.1    KQ971361    EFA08671.2    ABLF02030750    KQ434924    KZC11585.1    KPI93156.1    ODYU01001747    SOQ38363.1    KQ977279    KYN03989.1    BABH01037651    PZC77733.1    GFTR01007370    JAW09056.1    KPJ17669.1    APGK01038976    APGK01038977    APGK01038978    APGK01038979    KB740966    ENN76911.1    ACPB03014175    GEDC01030362    GEDC01016970    JAS06936.1    JAS20328.1    OWR42228.1    APGK01038973    KB631578    ENN76910.1    ERL84404.1    PNF33024.1    OAD51996.1    KZC11586.1    GFTR01007803    JAW08623.1    GEDC01029848    JAS07450.1    GBHO01025619    GDHC01000641    JAG17985.1    JAQ17988.1    EFN60962.1    EZA56496.1    RLU17785.1    JH431785    GEZM01042994    GEZM01042993    JAV79402.1    GECZ01002733    JAS67036.1    GANO01004466    JAB55405.1    EEB12161.1    GFDF01009383    JAV04701.1    GFDF01009382    JAV04702.1    EGI68512.1    GFDF01009381    JAV04703.1    CVRI01000053    CRK99823.1    EFN84344.1    GFDF01009380    JAV04704.1    UFQS01000367    UFQT01000367    SSX03211.1    SSX23577.1    GGMS01007197    MBY76400.1    KQ414855    KOC60127.1    ADTU01022996    GANO01004465    JAB55406.1    KYN03988.1    JH431250    KK853278    KDR09062.1    KYM79627.1    EFZ09435.1    KYN28134.1    PNF33018.1    EFA08184.1    LRGB01000915    KZS15182.1    GDIP01143974    JAJ79428.1   
Pfam
PF07690   MFS_1
Interpro
IPR020846   MFS_dom        + More
IPR011701   MFS       
IPR036259   MFS_trans_sf       
SUPFAM
SSF103473   SSF103473       

Ontologies

Topology

Length:
791
Number of predicted TMHs:
12
Exp number of AAs in TMHs:
261.39234
Exp number, first 60 AAs:
0
Total prob of N-in:
0.99477
inside
1  -  118
TMhelix
119  -  141
outside
142  -  155
TMhelix
156  -  178
inside
179  -  184
TMhelix
185  -  204
outside
205  -  213
TMhelix
214  -  236
inside
237  -  242
TMhelix
243  -  265
outside
266  -  269
TMhelix
270  -  292
inside
293  -  572
TMhelix
573  -  595
outside
596  -  609
TMhelix
610  -  632
inside
633  -  644
TMhelix
645  -  664
outside
665  -  678
TMhelix
679  -  701
inside
702  -  707
TMhelix
708  -  730
outside
731  -  739
TMhelix
740  -  762
inside
763  -  791
 
 

Population Genetic Test Statistics

Pi
181.61114
Theta
166.353423
Tajima's D
-0.75779
CLR
171.82485
CSRT
0.190840457977101
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号