SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10580
Pre Gene Modal
BGIBMGA003918
Annotation
major_royal_jelly_protein_1-like_precursor_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 2.292
 

Sequence

CDS
ATGAATACACTGAATCACAGAAAAAATAATTACAGTCCTCTCCTCAGTCCTTTTCCGAATACTCAGGAAGCGAAGAATATAGTTTCAGTATATGACATCGTCATAGATGGATGCCGGAGACTCTGGATGGTCGATACAGGGTTCATTGATGTTCCTGGTGACAGAAGACAGATTCAAGCACCAACAGTAACCATATTATTAGTGAGCATTAATAAATACGTGGTTTACCAAAAAATACGCATAGATCCAGAAGTACTTCGGAATGGAGTAACATCAGGTCTTAGAACCATCGCCATAGACTACATCTTACCTTGTTCGGAGACCTTTATGTACATAAATGATGACAGCAGTAACGCTGTTATCGTCTTTTCGCTGAGGAACAAGAGCTTTCAGAGGATCGTCAGATCGAATGCAAATGACGAAGCGTGGAGCTTTCCTGTACCAAAATCAATTGTAAATTACATGACGAACGTGGTCAGGTACCGACAGCCCCCGAACGAGACGTTTATACAGTATTCAGATTTACTGAAAACAACAATTGCCGATCGGGAGAAGTTACGCTCTGATGCGGAACTAAGCGAGCCCGATGCCAATCCCCGAGGGGTGTTGTACGAAAGAAATGTAGACAGCAACGTTTTATTTTTCACAAACGAAGAACGCACAATTCTGTTTTGTTGGAACGTGGACACACCCATGGTAGAAGAGAATGTAGCATTGCTCACCGACATATCGCCGGACAACGATTTTTATATATCCGCAATGGACACTAGCGGATATCGCTTCCAATTTATCGTCAATAGAATACGGGATATCAATAACAATATTTATAATGAACAAGATATAAATTTCGTCAATTATCAGATCCTTGTTGACGACATGCTGGAAAATACAACGTGCTCCGCAAGAACTCAGTGTTCGAATTTCCTTGATGAGTGGAGAGGGGAAAGTTCGAGACTATTTGGATATGATATTGACGGTGTCAAATATACGACTGATTCAGATTACGAACAATCAGTAGGTTCGATACAGTTCGAAAATGAAGTCGTAGAGGACAATGAAAAATTTCTTATACAAAAAAACTTAGTTCCTTACAGCACAGTCTATTTATTTTTGAGCCAAGTCGTGAGTATGCCCAGGACTAGACCAGGTATACCTTTCACTTTAAATATTATGGATATTTGGAATTATGGAAAAGATAATTACAGTCCACTCCTCAGTCCTTTTCCGAATACTCTGGAAGCGAAGAATATAATTTCAGTGTATGACATATTCAGGGATGGATGCAGGAGACTCTGGATGGTCGATACAGGGTTCATTGATATTCCTGGTGTCAGAAAACAAGTTCAACCACCGACAGTGCTCATAATAAGTGGACATCGACACGTGATCTATCAAAAAATACGCATAGATCCAGAAGTACTTCATAATGGGGTAACATCAGGCCTTAGAACCATCGCCATAGACTACATCTTACCTTGTTCGGAGACCTTTATGTATATAAATGATGACAGCAGTAACGCTGTTATCGTCTTTTCGCTGAGGAACAAGAGCTTTCAGAGGATCGTCAGATCGAATGCAAAGGACGAAGCGTGGAGCTTTCCTGTACCAAAATCAATTGTAAATTACATGACGAACGTGGTCAGGTACCGGCAGCCCCCGAACGAGACGTTTATACAGTACTCAGATTTACTGAAAACAACAATTGCCGATCGGGAGAAGTTACGCTCTGATGCGGAACTAAGCGAACCCAAAGCCAATCCCCGAGGGGTGTTGTATGAAAGAAATGTAGACAGCAACGTTTTATTTTTCACAAACGAAGAACGCACGCTTCTATTTTGTTGGAACGCGGACACACCCATGGTAGAAGAGAATGTAGCATTGCTCACCGACATATCGTCGAACAACGATTTTTATATATCCGGAATGGAAACTTCCGGATATGTCTTTAAATTCCTGGTCAACAGGATACGGAATATCGATAATAATATTTATAATGAACAAGCAATCAATTTCGCTAATTATGAGGCCCTAGTTCTCGAAATGCTGCAGAATACAACGTGCTCCGCAAGAACTGAGTGTTCCAACTTCCTCGACCAGTGGAACAAGGAAAGCTCAAATTATGTCATAGGTGACATCAAATATTACGCTAAATACATAACGGATGAATTCAAATCAGATTGGAAGAGAGACGTAGAGGCTATTTGGGACTAA
Protein
MNTLNHRKNNYSPLLSPFPNTQEAKNIVSVYDIVIDGCRRLWMVDTGFIDVPGDRRQIQAPTVTILLVSINKYVVYQKIRIDPEVLRNGVTSGLRTIAIDYILPCSETFMYINDDSSNAVIVFSLRNKSFQRIVRSNANDEAWSFPVPKSIVNYMTNVVRYRQPPNETFIQYSDLLKTTIADREKLRSDAELSEPDANPRGVLYERNVDSNVLFFTNEERTILFCWNVDTPMVEENVALLTDISPDNDFYISAMDTSGYRFQFIVNRIRDINNNIYNEQDINFVNYQILVDDMLENTTCSARTQCSNFLDEWRGESSRLFGYDIDGVKYTTDSDYEQSVGSIQFENEVVEDNEKFLIQKNLVPYSTVYLFLSQVVSMPRTRPGIPFTLNIMDIWNYGKDNYSPLLSPFPNTLEAKNIISVYDIFRDGCRRLWMVDTGFIDIPGVRKQVQPPTVLIISGHRHVIYQKIRIDPEVLHNGVTSGLRTIAIDYILPCSETFMYINDDSSNAVIVFSLRNKSFQRIVRSNAKDEAWSFPVPKSIVNYMTNVVRYRQPPNETFIQYSDLLKTTIADREKLRSDAELSEPKANPRGVLYERNVDSNVLFFTNEERTLLFCWNADTPMVEENVALLTDISSNNDFYISGMETSGYVFKFLVNRIRNIDNNIYNEQAINFANYEALVLEMLQNTTCSARTECSNFLDQWNKESSNYVIGDIKYYAKYITDEFKSDWKRDVEAIWD

Summary

Pfam
PF03022   MRJP
Interpro
IPR017996   Royal_jelly/protein_yellow        + More
IPR011042   6-blade_b-propeller_TolB-like       
IPR018247   EF_Hand_1_Ca_BS       
Gene 3D
PDB
3Q6T     E-value=8.7468e-07,     Score=129

Ontologies

GO

Topology

Length:
736
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.09156
Exp number, first 60 AAs:
0.0056
Total prob of N-in:
0.00524
outside
1  -  736
 
 

Population Genetic Test Statistics

Pi
230.899772
Theta
159.879983
Tajima's D
0.892735
CLR
0.120806
CSRT
0.629218539073046
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号