SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10578
Annotation
major_royal_jelly_protein_1_precursor_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.847
 

Sequence

CDS
ATGTACGGCAGCGGTTTCGCCCAGGCCGAGACACTGGGCACCGGCGCCGGAACGAACGCTGGCTTAGCCTGCGACACAGAGGGTGCCGAGGCTTTGATGTCTGGGCCGGAAGCTCGGAGGCGGGTGAATCCATCCGTCGATGAGGCGGGAGCGAGGTCGACCTCCATCTCCGAGTCAGAGTCGGAGGACGAGAAGGCGGGCGCAGGTGACCTACGAGTAGGTGTTTTGGACGGCGCGACGGAGGCCGCGGATGATCGCGCTGCTGGAACGGTGACCACGGCGGACGACGCAGCAGTTTTACTCGCCAGTATAGGCGACGCGGGAACGGCAGGCACGACGGAGGCTGCGGTGCTCGATGCAGAAGCTTTGCACGCAGCTTTAGATACAGTAGGGCGAGGATTTAATTTCATGGTTAATAGATTTAGAGGCTTAGTTGACAATATTTATGATGGGAATGCAATCAATTTCGCTGATTACAGCATCGACGTAGATGAAATGTTGAATAATACAAAATGCAACAAACCAACAAGATGTTCAAATTTCATTGACAATTGGAGAAATAAAATCCAGCGTTCTATCGGTTCAACGAAATACATGGTTAAACATGTAAGCGATGAGTACATACAATCAGAACTAGAAAGAAAGGGACTCCTTGGATGA
Protein
MYGSGFAQAETLGTGAGTNAGLACDTEGAEALMSGPEARRRVNPSVDEAGARSTSISESESEDEKAGAGDLRVGVLDGATEAADDRAAGTVTTADDAAVLLASIGDAGTAGTTEAAVLDAEALHAALDTVGRGFNFMVNRFRGLVDNIYDGNAINFADYSIDVDEMLNNTKCNKPTRCSNFIDNWRNKIQRSIGSTKYMVKHVSDEYIQSELERKGLLG

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
219
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00283
Exp number, first 60 AAs:
0.00158
Total prob of N-in:
0.03268
outside
1  -  219
 
 

Population Genetic Test Statistics

Pi
157.252907
Theta
155.052074
Tajima's D
1.312661
CLR
35.95217
CSRT
0.735913204339783
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号