SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10576
Pre Gene Modal
BGIBMGA014026
Annotation
major_royal_jelly_protein_1_precursor_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 3.329
 

Sequence

CDS
ATGAATTTGCTATTTGTATTAAATTTATTATTCGCCTCTAATGTTTATTGTGTACGTATTAAATACGAGAGAACTCATTACTGGAGATTGTTCGGTTACGACATAGACGGGGTTATATATACGACTGATTCCGACTACGAACACAAAAATGGTTCAATCTTATTCCGGGACGAAATATTGGAAGAACACGAAAAGTTTCTAATTCAAAAGAATTTGGTTCCAAACCACGTCGCCTTCAATTATAATAGTGTAATAGTATCTATTCCGAGGACGAGGCCAGGTATACCATTCACAATCAACAAGATGAATACTTACAACTTCCGTAAAAACAATTACAGTCCATTACTCATGCCTTATCCTACGTCGAAAGAATCAGAAAACATTATATCGGTCTACAAAACTGTCGAAGACGGCTGTGAAAGGTACTGGTTCGTCGATACGGGGTTCATAGATGTACCTGGCGTCAGAAGACAAGCTGGACCGGCCAGGATTTATATTTATAAATATCGTGGCGATAGCATTATTTTCATGGCCGACATTGACCCCAACGTTCTCAAAGACGGAATAACGGCAGGTCTTAGGTCTCTGACGATCGACTACATATTCCCTTGTAACGAAACCTTCGCGTACATCAGTGACGATAACGGTGACGCTGTCATTGCCTTTTCGTTTGAGGAAAAACGTTTCTGGAGGATCGAACGTCAAATCACTGGAAGCGAAGCTTGGACTTTCCCTATACCGCAATCCATTTTACTGTACGCTGAAAACGTTATAAGATACAGGAAAAGTCCGAACGAGACATTTGTACATTATTCAGATATTTTGAAAAATACGAAGATTTCTCAACGTTCCGGCCAAGATGTGACCGTGGATCTTAGTGAAAGAAATACAAATCCAAGTGGAGTTTTATACGACAGGAATTATGACGGCAACATTTTATTTTTCACGGATGAATCTCGCACTAATCTGTACTGTTGGAACATGGACACGCCGATGGATGAAGACAACGTTGAACTGCTCACTGATATTTCCAGGGACAACGACTTTTACATAAGCGGTAATTATTTCAAATATATCATTATATTAAAATTGTTAAGGCGTTTTAAACTTATCTTATTGTTCGAGGAAGATATCGTGTGTTTTATTTGA
Protein
MNLLFVLNLLFASNVYCVRIKYERTHYWRLFGYDIDGVIYTTDSDYEHKNGSILFRDEILEEHEKFLIQKNLVPNHVAFNYNSVIVSIPRTRPGIPFTINKMNTYNFRKNNYSPLLMPYPTSKESENIISVYKTVEDGCERYWFVDTGFIDVPGVRRQAGPARIYIYKYRGDSIIFMADIDPNVLKDGITAGLRSLTIDYIFPCNETFAYISDDNGDAVIAFSFEEKRFWRIERQITGSEAWTFPIPQSILLYAENVIRYRKSPNETFVHYSDILKNTKISQRSGQDVTVDLSERNTNPSGVLYDRNYDGNILFFTDESRTNLYCWNMDTPMDEDNVELLTDISRDNDFYISGNYFKYIIILKLLRRFKLILLFEEDIVCFI

Summary

EMBL
JN977510    AFC87790.1    DQ358086    ABC96701.1    JN977517    AFC87797.1    + More
JN977511    AFC87791.1    JN977518    AFC87798.1    JN977508    AFC87788.1    DQ358082    ABC96697.1    AK401603    BAM18225.1    AGBW02012516    OWR44954.1    AGBW02013493    OWR43338.1    GU063836    ADX87356.1    AXCM01005162    DQ358080    ABC96695.1    EF383145    ABO26383.1    DS231845    EDS35991.1    KZ150547    PZC70564.1    AXCN02000300    NWSH01000417    PCG76540.1    APCN01002105    EDS35990.1    AAAB01008879    EAA08438.2    JRES01000641    KNC29686.1    UFQS01002523    UFQT01002523    SSX14209.1    SSX33624.1    ATLV01013869    KE524905    KFB38230.1    AK402248    BAM18870.1    UFQS01000574    UFQT01000574    SSX05055.1    SSX25417.1    JN977507    AFC87787.1    SSX05054.1    SSX25416.1    EAU77002.3    ADMH02000272    ETN67175.1    GDHF01007573    JAI44741.1    GDHF01003649    JAI48665.1    GDHF01013800    JAI38514.1    CH477186    EAT48899.1    GAMC01016596    GAMC01016594    JAB89961.1    KFB38229.1    GAKP01008990    JAC49962.1    GEZM01072533    JAV65482.1    GBXI01008585    JAD05707.1    GAIX01004613    JAA87947.1    KQ459185    KPJ03193.1    GFDL01005075    JAV29970.1    KQ460949    KPJ10435.1    AXCN02001168    GDHF01013790    JAI38524.1    GU953230    ADF43214.1    ETN67174.1    GDHF01013000    JAI39314.1    GDHF01026140    JAI26174.1    JXJN01023775    EZ422957    ADD19233.1    GAKP01008988    JAC49964.1    CCAG010023921    RSAL01000070    RVE49172.1    CH940652    EDW59314.1    CP012526    ALC47451.1    KY221861    ATB56359.1    OUUW01000013    SPP87943.1   
Pfam
PF03022   MRJP
Interpro
IPR011042   6-blade_b-propeller_TolB-like        + More
IPR017996   Royal_jelly/protein_yellow       
IPR018247   EF_Hand_1_Ca_BS       
Gene 3D
PDB
3Q6T     E-value=2.57606e-06,     Score=122

Ontologies

Topology

SignalP
Position:   1 - 17,         Likelihood:  0.952804
 
 
Length:
382
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.08637
Exp number, first 60 AAs:
0.06883
Total prob of N-in:
0.00341
outside
1  -  382
 
 

Population Genetic Test Statistics

Pi
140.370658
Theta
148.250004
Tajima's D
0.228701
CLR
1.177778
CSRT
0.438078096095195
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号