SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10572
Pre Gene Modal
BGIBMGA006564
Annotation
PREDICTED:_uncharacterized_protein_LOC106135401_[Amyelois_transitella]
Location in the cell
PlasmaMembrane   Reliability : 1.339
 

Sequence

CDS
ATGCATAAAGACAGTCAGATACAGCCGTCGATACTGCCTCGGGTGCCGTGTGCTGTAACTGCTGATGCTCATCCACAAGCCCAGAGTGTTATCCATACTCTGGATGATTTGGCATCTTACAAAAATAAAATTCCTGTGCTTAAGCACATCCCTAAGGGGGCCAGGAATTTAGTCGCAGGAAAGCTCAGAGTGATTGTGGACGGCTGCATAAACAATAACGGTGTGGAGGACTGGGTTTCCTTGTTGTCATTTTCTTACACGACTCTGAGAATTCCAGATCGAGGTGACCCCCGTTCGCTTACTGCAAAGGTTAAGGAGAATGCAAACAATAATAGCCCGTATTTTTTAGAGGACTTCAAACATAAGCCACGATCCGCAGTCAAAAGAATCGAAGCCAAGGTTGATGAGGGTGATTTGCGTGAAGCTGTCCGTCTTTTAGTGTCGGAGGATTCTTTAGCACCTTTTAACGATGAGACCTTAAGCGCATTACGTGATAAAAATCCTACTCCTTTTCGTCCTTTATCATTGCCGCCAGCGCCTGATTCTAGTTGCCCTTTTTTGACTGTCAACTCGGAGGATGTTGCTGACGCAATTAGTTCCTTTTATAGCGGCTCTGCACCTGGCCTTGATGGTCTACGTCCAAACCATTTAAAGGAGCTCATTTCCCCTTCCGCCGGTGAAAATGGTGTTCGTCTATTGCACTCAATTACAGACTTATGCAATTTCATACTAAGAGGTACGGTTAATGTACAGGTGTGTCCTCATTTGTACGGAGGTAGCTTATGCGCTCTAACTAAGAAGGACGGCGGTGTGAGACCAATTGCGGTGGGGTCTGTGCTGCGTCGTCTCGCTGCCAAGCTTGGGTGTCGGTCTGTAAGGAATGAAATGGCCTCGTACTTGCAGCCCCACCAGCTGGGCTTCGGGACTGCTCTTGGGTGTGAGGCCGCCATTCATGCTACCCGTGCATTTGCTATGAGCAGGGAGAACTGTAACAGTGCAATTGTTAAGCTTGATATAAGGAATGCTTTTAATAGCTTAGAGAGAGATTTAATTTTAAATGAAATCAAGGAGAAGATTCCGGCTTTATACCCATTCTTGTATCAGTGTTACAGCTCTTCCAGCAAGTTGTTCTTTATGGAATCTTCCATTGACTCGGAGGTAGGTGCCCAGCAGGGCGATCCTCTTGGCCCATTAATTTTTAGTCTTGCTATCTACAGCATTATAAAGACCGTCAAGTCACCTTTAAACCTATGGTATTTAGATGACGGCACAATAGGTGGTCCCCCAGATTCCGTGCTAGACGACATCAGACTTTTGTTTCCGAAGTTGCGAGATGTCGGCTCGGAGGTTAATACTGGGAAATGTGAGGTATACTTTTCTACTGAAGTATCAGCAAGCGTAGTTAAAGATTTTCAGGAGTTGGTTCCAGGTATCAAAGTTTTGACTAAAAATGTAGCCCAGCTTGATGCTTTGTTGAGGGATACACTGGAGACTATTTTAAACGTAAGCTTGGATGACAGACAATGGTGCCAGGCTGTTTTGCCTATACGTCATGGCGGCCTGGGGGTGCGACAAATGGAGCGTACTGGGCTCGCTGCTTTCCTGGCTTCGTGTTATGGGGTTGTAGACTTTGTTGCTAAGTTACTGGGTACGAATGGTGATGGATCTACGATTCCGTTTGCGAGCGAGGCTTTGGCGGCTTGGGGCCTTTTATGTCCGAATGAGGCGCTCCCGGTGAACAGGAGCTCGCAGAGGTGTTGGGATGATGTGCTGTGCAAGCTGACTTTGTCAACTTTGCTGGGAGACGCCACTGGAGTTGAATTAGCGCGCCTGAAAGCGGTCTTCTGTCCGGAATCTGGTGCTTGGTTGCAAGCATTGCCTTCACCACAGCTGGGGACACTTCTTGATAATAATTCATTGAGAGTGGCCACAGCTTTGAGACTCGGTTGCAGCATTTGCGAGCCCCATCGATGTGTCTGTGGTAGTATGGTGGATGCCGCCGGACTGCATGGACTGAGTTGTGTTAGATCGGCTGGCCGCTTCCCGAGACACCATGCACTTAATGATATTATTCGACGTGCTTTGGTCACCGCAAATATCCCGTGTGTGTTGGAACCACCAGGCCTCAGCAGGTCGGATGGTAAGAGGCCGGATGGTTTGACTCTGATTCCTTGGGAGAAGGGACGCTGCTTGTTATGGGACGCAACCTGTAGCTGTACGTACGCGGCGTGTCATTTATCTGGGACCCGACAATGTGCGGGCTTTGCTGCTGAGGCGTCGGCTAAAACGAAGCATGCCAAGTACGATGCTCTGAAATCTACATACCTGTTTGTTCCAGTGGCAGTGGAAACGACGGGTGTGTGGAGTTCGGAGGCCAAAAAGTTTATTGCCGCAATTGGCCACCGCCTCAGAGGGCAAGGCCACGATCCTCGGTCTGGGTCGTACCTGGTTCAGAGATTATCCATTGCCATACAGCGTGGCAATGCTGCTAGCGTAATGGGTACTTTCGGGCCGGGTGCGATCCAGAGTGGCTTGTTTGACTAG
Protein
MHKDSQIQPSILPRVPCAVTADAHPQAQSVIHTLDDLASYKNKIPVLKHIPKGARNLVAGKLRVIVDGCINNNGVEDWVSLLSFSYTTLRIPDRGDPRSLTAKVKENANNNSPYFLEDFKHKPRSAVKRIEAKVDEGDLREAVRLLVSEDSLAPFNDETLSALRDKNPTPFRPLSLPPAPDSSCPFLTVNSEDVADAISSFYSGSAPGLDGLRPNHLKELISPSAGENGVRLLHSITDLCNFILRGTVNVQVCPHLYGGSLCALTKKDGGVRPIAVGSVLRRLAAKLGCRSVRNEMASYLQPHQLGFGTALGCEAAIHATRAFAMSRENCNSAIVKLDIRNAFNSLERDLILNEIKEKIPALYPFLYQCYSSSSKLFFMESSIDSEVGAQQGDPLGPLIFSLAIYSIIKTVKSPLNLWYLDDGTIGGPPDSVLDDIRLLFPKLRDVGSEVNTGKCEVYFSTEVSASVVKDFQELVPGIKVLTKNVAQLDALLRDTLETILNVSLDDRQWCQAVLPIRHGGLGVRQMERTGLAAFLASCYGVVDFVAKLLGTNGDGSTIPFASEALAAWGLLCPNEALPVNRSSQRCWDDVLCKLTLSTLLGDATGVELARLKAVFCPESGAWLQALPSPQLGTLLDNNSLRVATALRLGCSICEPHRCVCGSMVDAAGLHGLSCVRSAGRFPRHHALNDIIRRALVTANIPCVLEPPGLSRSDGKRPDGLTLIPWEKGRCLLWDATCSCTYAACHLSGTRQCAGFAAEASAKTKHAKYDALKSTYLFVPVAVETTGVWSSEAKKFIAAIGHRLRGQGHDPRSGSYLVQRLSIAIQRGNAASVMGTFGPGAIQSGLFD

Summary

Pfam
PF00078   RVT_1        + More
PF13966   zf-RVT
Interpro
IPR000477   RT_dom        + More
IPR004263   Exostosin       
IPR026960   RVT-Znf       

Ontologies

Topology

Length:
847
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0493099999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00024
outside
1  -  847
 
 

Population Genetic Test Statistics

Pi
0.101656
Theta
0.337467
Tajima's D
0
CLR
0
CSRT
0.536323183840808
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号