SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10571
Pre Gene Modal
BGIBMGA014026
Annotation
PREDICTED:_LOW_QUALITY_PROTEIN:_major_royal_jelly_protein_1-like_[Bombyx_mori]
Full name
L-dopachrome tautomerase yellow-f2      
Location in the cell
PlasmaMembrane   Reliability : 3.145
 

Sequence

CDS
ATGAACGTGCTACTCGTAATATTGTTAAGCCTACTATTCCTTTGTGGTACGATCTGCGTACATAATAAATACAAGAGGACGTATCTCTGGAAATTATTCGGCTACAACATTGACGGGGTTATATATACGAGTGATTCGGACTTTGAACACAAACGAGGCTCATTTACTTTTCAAGATGAACTGCTGGAAGATCACGAAAAATTTTTGATTCGAAAGAACTTAGTCCCGAACCACATTAGCTATGACCTCTTTCGTTCAATAATATCTATTCCTAGGACAAGGCCGGGTATACCGTTCACCCTCAATGAGATACCATATTTTAGCATATATCACAGTAATCACAGTCCTTTGCTCAAGCCTTATCCGTCGTCTAAAGAATCCAAAAACATTATATCGGTTTATGAAACCGCAATCGATGGATGTCAAAGATATTGGTTCGTTGACACAGGTTTCGTGGATATACCTGGTGTAAGAAAACAAGTCGTGCCTCCCAGCATTTATGTGTTTCAGGGCCGAATGGATTATCTTGTATATACATCTGATATAGATACTAGCGTTCTGAAAGACGGAGTATCGGCAGGTCTTAGGTCTCTGACGATCGACTACATTTTCCCTTGCCACGAAACCTTCGCGTACATTAGTGACGATAACGGTAACGCTGTCATTGCCTTTTCGTTTGAGGAAAAACGTTTCTGGAGGATCGAACGACAAATCACTGGAAGCGAAGCTTGGACTTTCCCCATACCGCAATCCATTTTACTGTACGCTGAAAACGTTATAAGATATAGAAAAAGTCCGAACGAGACATTTGTACATTATTCAGATATTTTGAAAAATACGAAGATTTCTCAACGTTCCGGCCAAGATGTGACCGTGGATCTTAGTGAAATAAATACAAATCCAAGAGGAGTTTTATACGACAGAAATTATGACGGCAACATTTTATTTTTCACGGATGAATCTCGCACTAATCTGTACTGTTGGAACATGGACACGCCGATGGATGAGGACAACATTGAACTGCTCACTGATGTTTCCAGGAACAACGACTTTTACATAAGCGTTACCGCATCGACGTCGATGAAATGTTGA
Protein
MNVLLVILLSLLFLCGTICVHNKYKRTYLWKLFGYNIDGVIYTSDSDFEHKRGSFTFQDELLEDHEKFLIRKNLVPNHISYDLFRSIISIPRTRPGIPFTLNEIPYFSIYHSNHSPLLKPYPSSKESKNIISVYETAIDGCQRYWFVDTGFVDIPGVRKQVVPPSIYVFQGRMDYLVYTSDIDTSVLKDGVSAGLRSLTIDYIFPCHETFAYISDDNGNAVIAFSFEEKRFWRIERQITGSEAWTFPIPQSILLYAENVIRYRKSPNETFVHYSDILKNTKISQRSGQDVTVDLSEINTNPRGVLYDRNYDGNILFFTDESRTNLYCWNMDTPMDEDNIELLTDVSRNNDFYISVTASTSMKC

Summary

Description
Tautomerization of L-dopachrome with decarboxylation to give 5,6-dihydroxyindole (DHI). Also catalyzes the tautomerization of the methyl ester of L-dopachrome and dopamine chrome. May play a role in melanization reactions during late pupal and adult stages.
Catalytic Activity
L-dopachrome = 5,6-dihydroxyindole-2-carboxylate
Biophysicochemical Properties
0.11 mM for L-dopachrome
0.31 mM for dopamine chrome
Similarity
Belongs to the major royal jelly protein family.
Keywords
Complete proteome   Glycoprotein   Isomerase   Melanin biosynthesis   Reference proteome   Secreted   Signal  
Feature
chain  L-dopachrome tautomerase yellow-f2
EC Number
5.3.3.12
EMBL
JN977510    AFC87790.1    DQ358086    ABC96701.1    JN977517    AFC87797.1    + More
JN977511    AFC87791.1    JN977518    AFC87798.1    JN977508    AFC87788.1    DQ358082    ABC96697.1    AK401603    BAM18225.1    AGBW02012516    OWR44954.1    AGBW02013493    OWR43338.1    GU063836    ADX87356.1    AXCM01005162    APCN01002105    DQ358080    ABC96695.1    KZ150547    PZC70564.1    AAAB01008879    EAA08438.2    AXCN02000300    EF383145    ABO26383.1    UFQS01000574    UFQT01000574    SSX05055.1    SSX25417.1    SSX05054.1    SSX25416.1    DS231845    EDS35991.1    NWSH01000417    PCG76540.1    ATLV01013869    KE524905    KFB38229.1    CH477186    EAT48899.1    KFB38230.1    JRES01000641    KNC29686.1    UFQS01002523    UFQT01002523    SSX14209.1    SSX33624.1    JN977507    AFC87787.1    ADMH02000272    ETN67175.1    KQ460949    KPJ10435.1    JXJN01023775    EDS35990.1    GDHF01007573    JAI44741.1    GBXI01008585    JAD05707.1    GDHF01003649    JAI48665.1    GDHF01013800    JAI38514.1    GAMC01016596    GAMC01016594    JAB89961.1    EZ422957    ADD19233.1    CCAG010023921    GAIX01004613    JAA87947.1    EAU77002.3    KQ459185    KPJ03193.1    GFDL01005075    JAV29970.1    RSAL01000070    RVE49172.1    GDHF01013790    JAI38524.1    CP012526    ALC47451.1    GAKP01008990    JAC49962.1    GDHF01026140    JAI26174.1    GDHF01013000    JAI39314.1    CH964272    EDW83564.1    CH940652    EDW59314.1    ETN67174.1    JXUM01140694    KQ569110    KXJ68758.1    AE014297    AY060728    AAL28276.1    CM000160    EDW97173.1    EAT48900.1    GAKP01008988    JAC49964.1    AXCN02001168    ACPB03000149    CH933806    EDW14389.2   
Pfam
PF03022   MRJP
Interpro
IPR011042   6-blade_b-propeller_TolB-like        + More
IPR017996   Royal_jelly/protein_yellow       
IPR018247   EF_Hand_1_Ca_BS       
Gene 3D
PDB
3Q6T     E-value=3.63445e-08,     Score=138

Ontologies

Topology

Subcellular location
Secreted  
SignalP
Position:   1 - 19,         Likelihood:  0.769083
 
 
Length:
363
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
17.0112999999999
Exp number, first 60 AAs:
16.98595
Total prob of N-in:
0.53507
POSSIBLE N-term signal
sequence
inside
1  -  1
TMhelix
2  -  24
outside
25  -  363
 
 

Population Genetic Test Statistics

Pi
196.058496
Theta
196.303156
Tajima's D
1.639907
CLR
0.133452
CSRT
0.819859007049648
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号