SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10570
Annotation
PREDICTED:_uncharacterized_protein_LOC101737203_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.229
 

Sequence

CDS
ATGTCGACGTCGGGCTACCTAGTTAATGTGCCGAAACTCAAAGGTCGCGAAAATTACGATGATTGGGCGTTCGCAACAAGTAATTTTTTGCTGCTCGAAGGCATTGACTTGGAGAACCTTTCCGCAGAAATGAGTGAAGCTGAGATAAAAAAAGCCAAAGCCAAACTCGTCATGACTATTGACTCTTCATTATACGCGCATATCAAGAGTGCAAGTGCACACCTGACGGCAAGTCGAGATTGTTTACAGTTAAATAGACCCGTGCATGAAAACAAAGAAATAGTAGTTGCAAATCAAATGACTGTGCCTGTTGTGAGTGTTGGTGAAACACAGATAACCACGATTGTAAATGGTTCTCAGTATGATGTCATTGTAAAGAATGTTTTATACATACCGAAGCTCACGACAAACTTATTATCGGTAAGTCAACTGATAGCAAATGGCAACAAAGTGTCATTTAAGAAGGATGTTTGTTTAATATATAATCCAGTAAATGAGCTTATAGGAATTGCAAACTTAACTAATGGTGTGTACAAACTACAAATACAAAGACCAGAGAGTGCATTATTGGCCATGACAATGTGGCATAGAAGACTAGGACATGTAAACAGTAAATCTTTAGAAATGATGAAAGAAGGTGCTGTGAAAGGGGTTACTTTTGATAAGAAAGCTGATATTCAGATCAAGAACTGTGAAGTGTGCTGTGAGGGCAAACAGGCTCGTTTCCCTTTCCCATCTGCTAATCATAGAAGTGATATACTACTAGAAGTAATACACTCAGATTTATGTGGGCCGATGGAGACCAAATCAATTGGTCAAGCAAAGTACTTTCTTCTGTTCATAGATGATGCCAGCAGAATGACTTATGTCTATTTCTTGAAGGAAAAGAACCAAGTATTCCAGCATTTCAAAGAATTTCGTGTTTTGGTGGAGAATCAAACAGGAAACAAGATCAAAATATTGAGAACAGATAACGGAGGTGAGTTTTGTTCACAAGAGATGGAAGACTTCTTAAAACAAACTGGAATCATCCATCAGAAGACTAATCCTCACACTCCACAACAGAATGGACTCTCAGAAAGGTTCAACAGAACTGTAGTTGAACGGGCTAGATGTTTACTGTTTGAATCAGATCTCGACAAAAGTTTTTGGGGTGAAGCAGTGAATACTGCAGTATACCTAATGAATAGAATGCCAGCTGTCAGTCTAGGCATGATAACACCATTTGAGAAGTGGACAGGCAAGAAGCCAGATTTGAGCTATGTCAGGATTTTTGGAAGTAAAGTAATGGTGCATGTTCCCAAAGTGCAAAGACAAAAATGGGATAAGAAGGCTGACAAATTAATTCTAGTTGGTTATCCGGATAACGTGAAAGGTTACAGATTATATAACCCCAAAACCAAGAAGATTACTACGAGCAGGGACGTCATTATAATAGAGAAAGAACACTCGGACACAGCTCAGGTAGTAGTAAATAATGAAAAAGTGTTGGAGAAAGTTGAAAATTCAGAGAAAGAGAGAAGCATATCAGAAAATTCAACTATAGACGCTAACAATCCTACATATATTTATGACTCATCGAGCTCCCACGAAGATTCATATCAATCGGTGTATGAAAGTGAAAATGAGTCAACCTTAGAATCCATTTTAGAAGAAAATATTCAAAACTTACAGGAGCTTGGTAAGCGCAAGAGAAAGCCAGTAGAAAGATATGGCTATTCCAATCTCTGCATTGTAGATGAGCTGGAATCCTGTGGTGAAGAACTGAGTTATGAAACAGCAATAAATGGACCAGAGAAGGAACTGTGGGAACAGGCGATGGCAGAAGAACTGAAGGCATTTGAAGAAAACCAAGCATGGGAATTTGTTGACAGAAAAGAAGCTGATAGGATAGTGCAATGTAAATGGGTTTTTAAGAAAAAGTTTGAATGTGATGGTAAAGTGCGTTATAGGGCTAGACTGGTAGCAAAAGGTTTTACTCAAAAAGAAGGTGTGCGAAAGCAAGTACAACCAGCATCATTGATACTTTACAGTACTAATTTAAGACCAAAGTTTCAGTTCAGGAAAAATATTGACAGTGCTTTTCTCCACAATGGTATCACTAGTGGACTCCGATCTCTATCGGTTGATTTTATATTACCGTGCTCCGAGTCTTACGTATACATTACTGACGACACTACCGGCGACCTCATTGTCTTCTCGCTTCAGGACTTGCGTTTTACGAAAATCAGCCGCGCAAGTAATACGGCTGATTCTTGGGAATTTATTGTGCCACAGTTTGAAACACAATACAGGTTAGAAGTTGAAAAATATAGAAAAAGGCCAAAAGAAACGTACGAACACTATGTGGATTTTTTAAATTCTACAAATCAACTGTATGATCCAATAAGTGATTCAAGACCTCGTGATACATTTAACAACACCTACTATCCAAATTATGAAGGGTTGCTCTACACGAAAAATTTTGAAGGAAACATTTTGCTATTCACGAATTGGAACCGTAACAAGCTTTACTGTTGGAATATGGATACTCCATATGAAGAAGAAAATGTTGATTTACTCGCGAGACTCGATGAGGCTGACTATAGATTTTCAGCCTTAGACGCATCGGGTAGCGGTTGTTACGCACTAATACAGAGAACTTTAAATAGCACGTCGTCAAAGTTCAATGAAGAGAAATACAATTTTTGGTTTTTCTCAAATAACCTTGAGGAGCTGCTGGAGGGATCAAAATGCACCAAGAGTAACCAGTGCACGGATTACGTGATGCGGAGATCGGCGAGCCAAACATTACTATTTTCCAAAAGAATAGCACCAAAATACGTATCTGATAACGTCATTAGAAATGTTGAAAATATATGGAAGGTCAAGGGCATTGTGAATTAA
Protein
MSTSGYLVNVPKLKGRENYDDWAFATSNFLLLEGIDLENLSAEMSEAEIKKAKAKLVMTIDSSLYAHIKSASAHLTASRDCLQLNRPVHENKEIVVANQMTVPVVSVGETQITTIVNGSQYDVIVKNVLYIPKLTTNLLSVSQLIANGNKVSFKKDVCLIYNPVNELIGIANLTNGVYKLQIQRPESALLAMTMWHRRLGHVNSKSLEMMKEGAVKGVTFDKKADIQIKNCEVCCEGKQARFPFPSANHRSDILLEVIHSDLCGPMETKSIGQAKYFLLFIDDASRMTYVYFLKEKNQVFQHFKEFRVLVENQTGNKIKILRTDNGGEFCSQEMEDFLKQTGIIHQKTNPHTPQQNGLSERFNRTVVERARCLLFESDLDKSFWGEAVNTAVYLMNRMPAVSLGMITPFEKWTGKKPDLSYVRIFGSKVMVHVPKVQRQKWDKKADKLILVGYPDNVKGYRLYNPKTKKITTSRDVIIIEKEHSDTAQVVVNNEKVLEKVENSEKERSISENSTIDANNPTYIYDSSSSHEDSYQSVYESENESTLESILEENIQNLQELGKRKRKPVERYGYSNLCIVDELESCGEELSYETAINGPEKELWEQAMAEELKAFEENQAWEFVDRKEADRIVQCKWVFKKKFECDGKVRYRARLVAKGFTQKEGVRKQVQPASLILYSTNLRPKFQFRKNIDSAFLHNGITSGLRSLSVDFILPCSESYVYITDDTTGDLIVFSLQDLRFTKISRASNTADSWEFIVPQFETQYRLEVEKYRKRPKETYEHYVDFLNSTNQLYDPISDSRPRDTFNNTYYPNYEGLLYTKNFEGNILLFTNWNRNKLYCWNMDTPYEEENVDLLARLDEADYRFSALDASGSGCYALIQRTLNSTSSKFNEEKYNFWFFSNNLEELLEGSKCTKSNQCTDYVMRRSASQTLLFSKRIAPKYVSDNVIRNVENIWKVKGIVN

Summary

Pfam
PF13976   gag_pre-integrs        + More
PF00665   rve
PF13961   DUF4219
PF07727   RVT_2
PF00098   zf-CCHC
Interpro
IPR036875   Znf_CCHC_sf        + More
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR013103   RVT_2       
IPR001584   Integrase_cat-core       
IPR039537   Retrotran_Ty1/copia-like       
IPR025314   DUF4219       
IPR025724   GAG-pre-integrase_dom       
IPR036397   RNaseH_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
Gene 3D
PDB
1C1A     E-value=0.000329911,     Score=108

Ontologies

Topology

Length:
961
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01458
Exp number, first 60 AAs:
0.00047
Total prob of N-in:
0.00066
outside
1  -  961
 
 

Population Genetic Test Statistics

Pi
225.588261
Theta
18.761257
Tajima's D
0.20598
CLR
0.062102
CSRT
0.433278336083196
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号