SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10568
Pre Gene Modal
BGIBMGA014032
Annotation
reverse_transcriptase_[Danaus_plexippus]
Full name
L-dopachrome tautomerase yellow-f       + More
L-dopachrome tautomerase yellow-f2      
Major royal jelly protein 5      
Major royal jelly protein 1      
Major royal jelly protein 4      
Alternative Name
Bee-milk protein
56-kDa protein 4
Apalbumin 1
Apisin subunit MRJP1
Royalactin
Royal jelly protein RJP57-2
Location in the cell
Nuclear   Reliability : 2.139
 

Sequence

CDS
ATGAACGACTCGGATTACGAATACAAAGAAGGGACGTTTCATTTTCAGGACGTGGCCTTAGAGGAACATGAAAAGTTTCTAATAAGACAAAACTTGATTCCCTATGATTTTATTTATGATGTTCCTCAAACAACGATAAGCATCCCTAGAACTCGACCTGGAATACCATTTACTGTCAACTTTATTGATAACTTTCTTCATGAAAAAGAGCCAATGCTAAGACCATTTCCTAATTCAAAGGAAGGTAAAGAATTTACATCGGTTTTTAACATGTTTGAAGATGGTTGTGATAGGCTTTGGTTTGTTGATACAGGATACCTCGATATCCCAGGTGTACGAAAGCAAGTACAACCAGCATCATTGCTACTTTACAATAGTCTTCCAAAACCAAATTTTCAGTTCAGGAAAGATATCAACAGTGCTTTACTCCATAACGGTATCACTAGTGGACTCCGATCTTTATCAGTTGATTTTATATTACCGTGCGCCGAGTCTTACGTATACATTACTGACGACACTACCCGCGACCTCATTGTATTCTCGCTTCAGGACTTGCGTTTTACCAAAATCAGCCGCGCAAGTAATACGGCTGATTCTTGGAAATTTGTTGTACCACGATTTGAAATACAATTCAGGCTAGAAGTTGAAAAATATAGAAAAAGGCCAAACGAAACATACGAACACTATGTCGATTTTTTAAATTCTACAAATCAACTGTATGATCCAAAAAGTGATTCAAGACCTCGTGATACATTTAACAGCACCTACTATCCAAATTATGAAGGGATGATTTATACGAGAAATTTTGAAGGAAACATTTTGTTATTCACGAATTGGAATCGTAACAAGCTTTACTGTTGGAATATGGATACTCCGTATGAAGAAGAAAACGTTGATGTGCTCTCGAGAATCGGTGAGACTAAATATAGATTTTCAGCTTTAGATGCGGTTGGTAGCGTTTTGCACGGACTAATGCAAAGAACTTTAAAGAGCACGTCGTCAAAGTTCAATGAAGACGAAAACAATTTTTGGCTTTTCTCAACGAACCTTGATAAGCTGCTGGAAGGATCAAAATGCTCCAAAACTTATGATGCTAAACGTAACTTTACATATGAGCATGGTTGGAAACTGTTTAGTTACGATATTGATGGAGTAAAATACACGAATGACTCGGATTACGAAAACAACGAAGAGTCGTTGGGCTCTCAGGGCCTGGACTTAGAGGAACATGACAAGTTTCTAATAAGACAAAATTTGATACCCTATGATATTAAGGAAGATGTAGTGCGAACAACAATAAGTATCCCTAGAACTCGACCTGGAATTCCATATACAGTAAACTTTATTAGTAATCTGGATGATAAGGAGCTAATGCTAAGACCATTTCCTAATTCAAAGGAAGGTAAAGAATTAGTATCGGTTTTTAACATGTTTCAAGACAGCTGTTCTAGACTTTGGTTTGTTGATACAGGATACCTCGATATCCCAGGTGTACGAAAGCAAGTAAAACCAGCATCATTGTTACTTTACCTTAGTTTTTCAACAGCAGATCTGCAGTTTAGGAAAGATATTGACAGTGCTTTACTCCATAACGGTATCACTAGTGGACTCCGATCTCTATCGGTTGATTTTATATTCCCGTGCGCCGAGTCATACGTATACATTACTGACGACACTACCCGCGACCTCATTGTCTTCTCGCTTCAGGACATGCGTTTTACGAAAATCAGCCGCGCAAGTAATACGGCTGATTCTTGGAAATTTATTGTGCCACAGTTTGAAACACAATACAGGCTAGAAGTTGAAAAATATAGAAAAAGGCCGAATGAAACATACGAACACTATGTGGATTTTTTAAATTCTACAAATCAACTGTATGATCCAAGCAGTGATTCAAGACCTCGTGATACATTTAACAACACCTACTATCCAAATTATGAAGGGATGATCTATACGAGAACTTATGAAGGTAATATTTTGTTATTCACGAATTGGAATCGTAACAAGCTTTACTGTTGGAATATGGATACTCCATATGAAGAAGAAAATGTTGATTTGCTCACGACAATCGATGAGACTAAATATAGATTTTCAGCTTTAGATGCGTCGGGTAGCGTTTTACACGGACTAATACAAAGAACTTTAAATAATACGTCGTCAAAGTTCAATGAAGACGAAAACAATTTTTGGCTTTTCTCAAAGATCATTAAGGAGCTGCTGGAGGGATCAAAATGCTCAGAGAGCAACCAGTGCACGGATTACCTGACGCGGAGAACGGAGAGTCAATCATTATTATTTATCAAAAAAATATCACCGAAATACGTAACCGATACCGTCGTTAGAAAGTTTGAAAAAATATGGAAGAGGGTACCTCCCGCTCCGCGGGGGAGAATCCCTCCGTGCGGTCGAGCGATCGGCCGCACGCTGCCCCACCGTTTCTGGGGGGGCACACACTGTCACGCAGAAGGGGGCGACAGCACGGGTCGCGTAAGGGACAGGGTCCCCACCGTGCGCCTCGAGCGCTGCGAGAGCCTTATCTCGCTCTACTCGGCGCGGAGCTCCGCGAGGGGCGACGCGTCCAGTGGGCGGGAGACACCGGCGCTGTTCACCGACACTCGACAGCGGACTCGGCGGAAGCGGAAGTCGGCCCGACGGCCGGCGTCCTCCGCTCCGTCTGACTCGTCCGAGGGTGAGCCTGCCAGCGCCAAATATATGGCGTTGGCGGAAGGGCCGGCGGCTGCTGCGGCGCCGCCCGCCACAGATTGTGACGCAGTCTCTTCTCGCGGACTGGCTGCTGCCTCCTCGGCGCAGTCCAGGGCCGCCTGCTGTGAGGCAAGAGGAAAAGCGGAAACCGGAGAGGTCGCGCGTTTGGAGCGCTGCCTGGCCGGGGTGGGTCCCTCTGACCCCTTCCGAGCATTCGAGGTGGTTGGGAAATTGGTTTCCGCAGTCGTGGCAACATCCGGCGGTGGACTCAAGGGTGACTGCGTGCGGGCCTTAAAATCCGGAGCGGCCACCCTAGAAGAACGTCTGAGGGAAGTGGTAGACCGCACCACAACGACGGAGACGGCGGGCTTGCGGCAGGAAGTGGCCCTGCAGCACGCCCGCCTCGAGCAACTCTCGAACGAGAATGGCAAACTTCGGGCGGAGAATGGGCAGCTGCGAGTGGACATGGCCGAGTTGAGGACCATGGTTGCCGACCTCATCGAGCGGCAACGCAGCTCGGCCCCTGCCCCTCCTCCGCCCGAAGCGGAAGGCCTCAGTGAGGTGGACGAGTTGAGGCGGCAGCTCCTCATACAGGAGGCGCGCAGCTCCAAGGTGGAGCGCGCGAGACCGCCCCTCGCTCACGAGGCTAACGGAACCCCGGCCAACATGGACGAGGCCTGGACGACGGTGGTGCGGCGAGGGCCCAAAAAGGTTGCGGCGCCTGTCGCGCCGCGCCCCAAGCCCGCCCCTACGGCCGCCGCTCCCCGCCAAGAGGGTCGAGCGGAGCCTAGGGGCCGAACTGGACGAAGGAGGCCGCGCGCCCCGCGGTCGGCTGCAGTAGTCGTGGAGCTGCTGCCGGCCGCCAAAGAACGGGGCATCACGTACCACGACGTGATGACTCAGGCGCGCGGCGGCGTAAATGTGGACGCCCTCGGCGTGGAGGGTGGCCTGAAGGTCCGGCAGACGGCCAACGGGGCCCGCCTGGTAGAATGCCCCGGCGCGAATTCCAGCGCCGCGGCAGAAAAACTGGCGGTCCGTCTGCGGGAAATCTTGCCGGACCCCGAGGTGGTGCGCATCGCGCGGCCCGTAAAAATGGCGGAAGTGAAGATTACGGGCCTCGACGAGTGCGCCACGAAGGAGGAGGTCGCCGCGGCCATCGCGTCGCAGGGCAACTGCGCCCTCGCCGACGTCAAAGTCGGGGAGCTCCGGGCGACGTACTCCGGAACCCGGACGGCGTGGGCGCGTTGCCCGGTAGCAACGGCGAACCTCCTGGCCACCCCTCCACAGGGTCGGCCTTCGGACAGCCCAGGATGGCTGCGCGTGGGCTGGGTAGTGGCCCACGTGCAACTGCAGGAGAGCAGGCCGTGGCGTTGTCTTCGGTGCTTCGGCACCGGCCACGGCCTCGCCAAGTGCCCCTCGACAGTGGACCGCAGCGACCTGTGCTTCCGCTGCGGCCAACCGGGGCACAAGGCAGCCTCCTGCACCGCAGCCGCGCCGCACTGTGTCTTGTGCGACGCGGCTAAAAGGAAGGCCGACCACCGGGCCGGGGGCCCGGCGTGCAAGTCCGCCCCTCCTCTACAAAAACGAGGAGGGGCGGAAAGAAAAAGAAGCCGGCTGCAAAAAGGGCAGCCGGATCTCCTCGTCCACACCATGGCGGAGTGGTCAATCGATGTTGCTGTCGCCGCGGAGCCGTATTTCGTCCCCACCGACCAGGACTGCTGGATCGGGGACGTCGACGGCTCAGTGGCCATTATATTACGACAGTCCGCGGCGTTACCCCCCTTGGATATGGTGGCCAGGGGACCCGGGTACGTCGCGGCTAGGATCGACGGGACCGTCGTGATCGGGGCGTACTTTTCTCCGAATAGGAGCCTCGCCGAGTTCGAGCGGTTTCTGGGCGGGCTCGAGGCGCTTTTACACCGCCTCGGGTCCCGCCCTGTCATCGTCGCGGGGGACCTCAATGCCAAGTGTACGGCTTGGGGTTCCCCCCGCACGGATTCGCGAGGCGGGGCCCTTTCGGAGTGGGCGATCGCGACCGGCCTCTGTCTCCTAAACAGAGGCACGGTCGCGACTTGCGTGCGGTGGAACGGGGAATCTCACGTGGACGTGACGTTCGCGTCCCCGTCCGCCGTGCGCCGCACCCGCGGCTGGCGCGTACTCGAGGGGGCGGAGACGCTCTCGGACCACAGATACGTCCGATTCGAGCTCTCCGCCTCCTCCTTGTCGTCGTCGTCAGCCGTGGGCGCCCGCGGCGAGGAGGAGCTCCCGCAAGGTGCGCCCCGTTCGTTCCCCAGGTGGGCCTTGAAACGGATGAACAAGGAGTTGCTGATGGAGGCGGCCGCTGTTGCTGCGTGGGCGCCAAAACCCGCGCGACTCGCGGACGTGGATGCGGAGGTCGACTGGTTCCGGGGCACCATGGCAAACATTTGTGATGCCGCCATGCCCCGGGTCGGCCCCCGAGCACCACGTGGGGGTGCGTTCTGGTGGTCGCCCGAGATCGCAAGACTCCGCGAGGAGTGCGTGAGGGCGCGCCGCCGGAGCGCACGCCACCGCCGCCGCCGTCGTCGCGACGCTGCGTTCGCGGAGACGGCGGCCCAGCTGCACGCTGACTGTCGTCAAAAGCAGACGGCGCTGCAGCTGGCCATCGGCGAGGCCAAGAAGCAGAGCATGAAGACTCTCCTGGAGTCGCTCGACGAAGATCCCTGGGGGCGCCCATACAAGATGGTTCGCAGGAAACTGCAGCCGTGGGCGCTCCCGATGGACGCCACGTGGGGCACGCCTCCGCGTCGCCCCAGCGTTCCCGCTGCCGAGGAGCCCCCTCCCCCTATCACGGGGGCGGAGATCCATGCGGCCGTGTCCAGAATGAGAGCGAAGGACGCGGCCCCCGGCCCTGACGGCGTTCACGGCCGGGTCTGGAGCTTGGCCTTCGAGGCCCTAGGGGACCGGCTCGGGGGGCTTTTCGAAGCGTGCCTCGAGTCGGGACGGTTCCCGTCGAAATGGAAGACGGGCAGACTGGTCCTTCTGCGGAAGGACGGGCGCCCCGCGGACTCACCCGCGGGCTATCGCCCCATCGTGTTGCTGGACGAAGCGGGCAAGATGCTCGAGAGGATCGTCGCGGCCCGCATCGTCCGGCACCTGACCGAGACGGGTCCCGATCTTTCGGCGGAACAATACGGCTTCAGAGAGGGCCGCTCGACGATAGACGCAATTCTGCGCGTGCGTGCCCTCTCCGACGAAGCCGTATCCCGGGGCGGGGTGGCGATGGCGTTATCCTTAGATGTAAGGAACGCCTTCAACACCCTGCCCTGGTCGGTGATCGCGGGGGCGCTGGAGTATCACGGCGTCCCCGCATACCTCCGCCGACTGATCGGCTCCTACCTCGAGGGCAGGTCGATCCAGTGCATCGGACACGGTGGGGCGATGTACCGCTTCCCCGTCGAGCGCGGTGTTCCGCAGGGGTCTGTCCTGGGCCCCCTGCTGTGGAACATCGGCTACGACTGGGTCCTGCGGGGCGTCATTCGGGGTCCCCTCCCCGGGCTGAGCGTAATATGTTACGCCGACGACACGTTGGTCGTGGCTCCGGGGAGGGACTACCGGGAGTCTGCCCGTCTGGCGTGCGCAGGCGTGGCACACGTCGTCACAAGGATCCGACGGCTGGGACTCGAGGTGGCGCTCGACAAAACCCAGGCCCTGTTGTTTCACGGGCCGGGACGAGCGCCGCCTCTGGGTGCCCACCTCGTGATCGGAGGCGTCCGCGTCGGGGTCGGGGTGACCGGTCTTCGGTACCTCGGCCTTGAACTGGATGGTCGGTGGAACTTCCGCGCTCACTTTGCGAAGTTAGGCCCTCGACTGATGGCGACGGCCGGCTCTTTGAGCCGGCTGCTTCCAAACGTCGGGGGTCCCGATCAGGTGGCGCGCCGCCTCTACATGGGGGTGGTGCGGTCGATGGCACTATACGGCGCGCCCGTATGGTGCCACGCCCTGACCCGCCAGAACGTCGCCGCGCTGCGACGTCCGCAGCGCGCGATCGCGGTCAGGGCGATCCGAGGATACCGCACCGTCTCCTTCGAGGCGGCGTGCTTGCTCGCCGGGGCGCCACCCTGGGACCTGGAGGCGGAGGCGCTCGCTGCCGATTACCGGTGGCGTAGCGACCTCCGCTCTAGGGGGGAAGGGCGCCCCAGCGAAGGTGTAGTTCGAGCGCGGAGGCTCCACTCTCGGCGGTCCGTGCTGGAGGCGTGGTCTCGCCGCTTGGCGGATCCGTCGGCCGGCCTCCGAACCGTCGAGGCGGTCCGCCCGGTTCTCGCGGACTGGGTGGGCCGCGACCGCGGATGCCTCACCTTCCGGCTAACGCAGATGCTTACCGGCCATGGTTGTTTCGGCCGGTACTTGCACAAGATAGCCGGAAGGGAACCGACGGCGCAGTGCCACCACTGCGCGGACCGCGACGAGGAAGACACAGCGGAACACACATTGGCGCGTTGCTCTGGATTTGACGAGCAACGCGCCGCCCTCGTCGCGGTCATAGGAGAAGACCTCTCGCTGCCGCGCGTCGTGGCTACGATGCTCGGCAGCGACGCGTCCTGGAAGGCGATGCTCGACTTCTGCGAGTCCACCATCTCGCAGAAGGAGGCGGCGGAGCGAGAGAGGGAGAGCTCTTCCCTTTCCGCACCGATCCGTCGCCGTCGAGCCGGGGGCCGGAGGCGGGAATACGCCCCATTCTACAATGATAACGGACTCGCGCGGCAACGCGATCAAATTTTCGAATTCCTCCGCGACAATCTTGTAGATATTTTGTTAGTGCAGGCGACCTGCCTGAAGCCCTCGCGTCGTGACCCAAAAGTCGCGAATTACGTCATGGTTAGGAATGACAGACTCACCGCCTCCAAAGGCGGGACTGCTATTTACTATAGGCGGGCCCTGCACGTTGTCCCTCTCGATACTCCCTCGCTCTCACATATCAAGGCGTCAGTGTGCCGTATCTCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTATATCTCCCCCCGGACAAGCCCCTCCTGAGCAGTGACATCGAGTCACTGTTCGGCATGGGAAACTCTGTCATCCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGTACAAATGTTAACGGTAGGCGTCTCGACGCGTTTATAGACGACCTCACCTTTGAAGTAGTCGGTCCCCCAACTTCAACATGTTATCCGTATAACATCGCGCTCCGTCCGAGCACTATAAACCTGGCACTGCTTAGGAACGTAACTCTGCGCTTGCGTTCCATCGAAGCACTGTCAGAGCTCGACTCAGACCACCGACCTGTCGTTATGCAGCTCGGTCGCCCTCACAACCCAGTCACTGTTACGAGGACCATGGTGGATTGGAATAAGCTAAGCACGTGCTTAGCCGAAGCCGCTCCACCAATCCTCCCTTACGGCCCGGATTCGAATCTATCCCCCGAGGACACCGTCGAGTCCATAAACATCATTACCGATCACATCTCTTCCGCGATCATTAGATCTTCAAAAGAAGTCAATGTGGAGGACAGCTTCCACCGCATCAGACTGTCCCCCGATCTTAGGAATCTCTTAAGAGTTAGGAACGCGGCAATCCGGGCCTACGATCGTCTTCCCACGCATTCAAACCGGATTTGGATGCGTCGTCTACAACGCGAAGTCCACTCCCGCCTAAGCGACGCGCGTAACGATAATTGGCATAGTTATTTAGAACAACTCGCGCCCTCCCACCAAGCATACTGGCGACTAGCTAGGACTCTCAAATCCGAAACTACCGCTACTATGCCTCCCCTCGTACGCCCTTCAGGCCAACCACCGGCATTCGATGACGATGACAAGGCTGAGCTGCTGGCCGATGTACTGCAAGAGCAGTGCACCACCAGCACTCAATACGCGGACCCCGAACACACCGAAAATTATTATCATATCGGCTGTGTTCTTCCTGCAAATAAGGATTGGACGCCGGACTCTGAATTTAAGTCTACATGGATATGTCTTAATTGTGCGACTAAATCACGTACTGTTAATGATGAAACTCCTGTCCGTGGCAATGTGAGGCCTCGAGCACCTGATACATCCAATGTTACGATGAGACCGTTGCGTGCTGGATCCAGGGAACGTGAGGGACCTGAATTACAGGTTGTCCCTTTAGAACAGGTCAGGAGTATAGTGCGCGCGGAAGTCCAGGAAGCTGTTGCTTGTTTCAGGGACACTATTCTTGAACTCAAGAGTGAAATCTCAACTCTTCGTGATAGTGTCTCCTTCATTAGTGACAAGTATGAAGCCATATCGAAAAGATTTCTTGAGTTTAACGACCATCTGAAAATTATTCCAACACTCAAAAACGAGCTCAGTATACTGGATTCAAGAATGCAATCCATTGATTCTCAATTCAACTTAAAAGAGCAGTGGAGCAGGAGATCTAATATAGAAATTCTGGGTATCCCCGAAAGGAAAGGCGAAAATCTAATAGAATTGGTCTCGAAAATTGCCGAGAGGGCGGGTTTTGCCTTGAATCCTCAGATAGACATCGATTTTGTTACAAGGGTTGCGCCGATGGACAGAAGCAGTAGCAGATCAAAGCCAGTTATTCTTAGATTTGTATCCCGGTATAGGAAGGATAACATGTTGGCTAAATTGCGGAGGTTGAAGGAATTGAAATCTTCTGATATTGGATTCCCACATGATTCATCTAGGCTTTATTTTAATGACCACCTCACGAAAAACAATAAACTTTTGTTAAAAAACGTAAAAAAATTAGCCAAGGAAAAATTTTACAAATACGTGTGGTTTGAAGATGAAGTTGGTTTTTTTGAGGATATTTCTGACACAATTATTACTAATCCGGGTGACGAATTTTTGTGCGTCAGCGATTTCAATATAAGGAATGCTTCTTGGGAGCTGATCGGTGTTGGTGGACCTTCTAGACTCTTGAATGGTGATCGAACCAAAAGATTCGTTTATCGTACCATCAAACGATACAATGAAGACTCTAGTGTAGATGACAGTTCAAGAAGTGGTCGCCCTCGGTCTGTTAGGACTCCAGCAGTGATAAAAGCTGTGAAGGCGCGAATTCAAAGAAATCCCAAACGTAAGCAGAAACTGTTGGCCCTTCAGATGGGGTTAAGCAGAACCACGGTGAATAGGGTGTTGAATGAAGACTTAGGGCTTCGGGCATATCGAAGAAAAACAGGACATCGTTTGAATGCTCGTCTAATGGACCTGAGACTGAAGAGATGCCGCGCTTTGTTGAAGCGCTCTAAGGAAGCTTCCCAATTAGTCGACAGAGTGCAACGTGGGCACTATCCGACTTCAGTGATAGTTTGGTGGGGTATTAGCTATGAAGAAGTGGCTGAGCCATACTTTTGTGTAAAAGGTATCAAAACATCGGCACAAGTGGATCAAGATACCATTCTTGAGAAGGTAATGAAGCCTCTCAACAACACCATGTTCAATAATCAAGAATGGTCCTTCCAGCAAGACTCGGCGCCAGGTCATAAAGCTCGGTCTACGCAGTCTTGGTTGGAAACGAACGTTTCGGACTTCATCAGAGCTGAAGACTGGCCGTCGTCTAGTCCCGATCTTAATCCGCTGGATTATGATTTATGGTCAGTTTTAGAGAGTACAGCTTGCTCTAAACACCATGATGATTTGGAGTCCCTAAAACAATCCGTACGATTGGCAGTGAAAAAATTTCCCATGGAAAGAGTGCGTGCTTCTATTGATAACTGGCCTCAACGTTTAAAGGACTGTATTGCAGCCAATGGAGACCACTTCGAATAA
Protein
MNDSDYEYKEGTFHFQDVALEEHEKFLIRQNLIPYDFIYDVPQTTISIPRTRPGIPFTVNFIDNFLHEKEPMLRPFPNSKEGKEFTSVFNMFEDGCDRLWFVDTGYLDIPGVRKQVQPASLLLYNSLPKPNFQFRKDINSALLHNGITSGLRSLSVDFILPCAESYVYITDDTTRDLIVFSLQDLRFTKISRASNTADSWKFVVPRFEIQFRLEVEKYRKRPNETYEHYVDFLNSTNQLYDPKSDSRPRDTFNSTYYPNYEGMIYTRNFEGNILLFTNWNRNKLYCWNMDTPYEEENVDVLSRIGETKYRFSALDAVGSVLHGLMQRTLKSTSSKFNEDENNFWLFSTNLDKLLEGSKCSKTYDAKRNFTYEHGWKLFSYDIDGVKYTNDSDYENNEESLGSQGLDLEEHDKFLIRQNLIPYDIKEDVVRTTISIPRTRPGIPYTVNFISNLDDKELMLRPFPNSKEGKELVSVFNMFQDSCSRLWFVDTGYLDIPGVRKQVKPASLLLYLSFSTADLQFRKDIDSALLHNGITSGLRSLSVDFIFPCAESYVYITDDTTRDLIVFSLQDMRFTKISRASNTADSWKFIVPQFETQYRLEVEKYRKRPNETYEHYVDFLNSTNQLYDPSSDSRPRDTFNNTYYPNYEGMIYTRTYEGNILLFTNWNRNKLYCWNMDTPYEEENVDLLTTIDETKYRFSALDASGSVLHGLIQRTLNNTSSKFNEDENNFWLFSKIIKELLEGSKCSESNQCTDYLTRRTESQSLLFIKKISPKYVTDTVVRKFEKIWKRVPPAPRGRIPPCGRAIGRTLPHRFWGGTHCHAEGGDSTGRVRDRVPTVRLERCESLISLYSARSSARGDASSGRETPALFTDTRQRTRRKRKSARRPASSAPSDSSEGEPASAKYMALAEGPAAAAAPPATDCDAVSSRGLAAASSAQSRAACCEARGKAETGEVARLERCLAGVGPSDPFRAFEVVGKLVSAVVATSGGGLKGDCVRALKSGAATLEERLREVVDRTTTTETAGLRQEVALQHARLEQLSNENGKLRAENGQLRVDMAELRTMVADLIERQRSSAPAPPPPEAEGLSEVDELRRQLLIQEARSSKVERARPPLAHEANGTPANMDEAWTTVVRRGPKKVAAPVAPRPKPAPTAAAPRQEGRAEPRGRTGRRRPRAPRSAAVVVELLPAAKERGITYHDVMTQARGGVNVDALGVEGGLKVRQTANGARLVECPGANSSAAAEKLAVRLREILPDPEVVRIARPVKMAEVKITGLDECATKEEVAAAIASQGNCALADVKVGELRATYSGTRTAWARCPVATANLLATPPQGRPSDSPGWLRVGWVVAHVQLQESRPWRCLRCFGTGHGLAKCPSTVDRSDLCFRCGQPGHKAASCTAAAPHCVLCDAAKRKADHRAGGPACKSAPPLQKRGGAERKRSRLQKGQPDLLVHTMAEWSIDVAVAAEPYFVPTDQDCWIGDVDGSVAIILRQSAALPPLDMVARGPGYVAARIDGTVVIGAYFSPNRSLAEFERFLGGLEALLHRLGSRPVIVAGDLNAKCTAWGSPRTDSRGGALSEWAIATGLCLLNRGTVATCVRWNGESHVDVTFASPSAVRRTRGWRVLEGAETLSDHRYVRFELSASSLSSSSAVGARGEEELPQGAPRSFPRWALKRMNKELLMEAAAVAAWAPKPARLADVDAEVDWFRGTMANICDAAMPRVGPRAPRGGAFWWSPEIARLREECVRARRRSARHRRRRRRDAAFAETAAQLHADCRQKQTALQLAIGEAKKQSMKTLLESLDEDPWGRPYKMVRRKLQPWALPMDATWGTPPRRPSVPAAEEPPPPITGAEIHAAVSRMRAKDAAPGPDGVHGRVWSLAFEALGDRLGGLFEACLESGRFPSKWKTGRLVLLRKDGRPADSPAGYRPIVLLDEAGKMLERIVAARIVRHLTETGPDLSAEQYGFREGRSTIDAILRVRALSDEAVSRGGVAMALSLDVRNAFNTLPWSVIAGALEYHGVPAYLRRLIGSYLEGRSIQCIGHGGAMYRFPVERGVPQGSVLGPLLWNIGYDWVLRGVIRGPLPGLSVICYADDTLVVAPGRDYRESARLACAGVAHVVTRIRRLGLEVALDKTQALLFHGPGRAPPLGAHLVIGGVRVGVGVTGLRYLGLELDGRWNFRAHFAKLGPRLMATAGSLSRLLPNVGGPDQVARRLYMGVVRSMALYGAPVWCHALTRQNVAALRRPQRAIAVRAIRGYRTVSFEAACLLAGAPPWDLEAEALAADYRWRSDLRSRGEGRPSEGVVRARRLHSRRSVLEAWSRRLADPSAGLRTVEAVRPVLADWVGRDRGCLTFRLTQMLTGHGCFGRYLHKIAGREPTAQCHHCADRDEEDTAEHTLARCSGFDEQRAALVAVIGEDLSLPRVVATMLGSDASWKAMLDFCESTISQKEAAERERESSSLSAPIRRRRAGGRRREYAPFYNDNGLARQRDQIFEFLRDNLVDILLVQATCLKPSRRDPKVANYVMVRNDRLTASKGGTAIYYRRALHVVPLDTPSLSHIKASVCRISLTGHQPIVIASVYLPPDKPLLSSDIESLFGMGNSVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEVVGPPTSTCYPYNIALRPSTINLALLRNVTLRLRSIEALSELDSDHRPVVMQLGRPHNPVTVTRTMVDWNKLSTCLAEAAPPILPYGPDSNLSPEDTVESINIITDHISSAIIRSSKEVNVEDSFHRIRLSPDLRNLLRVRNAAIRAYDRLPTHSNRIWMRRLQREVHSRLSDARNDNWHSYLEQLAPSHQAYWRLARTLKSETTATMPPLVRPSGQPPAFDDDDKAELLADVLQEQCTTSTQYADPEHTENYYHIGCVLPANKDWTPDSEFKSTWICLNCATKSRTVNDETPVRGNVRPRAPDTSNVTMRPLRAGSREREGPELQVVPLEQVRSIVRAEVQEAVACFRDTILELKSEISTLRDSVSFISDKYEAISKRFLEFNDHLKIIPTLKNELSILDSRMQSIDSQFNLKEQWSRRSNIEILGIPERKGENLIELVSKIAERAGFALNPQIDIDFVTRVAPMDRSSSRSKPVILRFVSRYRKDNMLAKLRRLKELKSSDIGFPHDSSRLYFNDHLTKNNKLLLKNVKKLAKEKFYKYVWFEDEVGFFEDISDTIITNPGDEFLCVSDFNIRNASWELIGVGGPSRLLNGDRTKRFVYRTIKRYNEDSSVDDSSRSGRPRSVRTPAVIKAVKARIQRNPKRKQKLLALQMGLSRTTVNRVLNEDLGLRAYRRKTGHRLNARLMDLRLKRCRALLKRSKEASQLVDRVQRGHYPTSVIVWWGISYEEVAEPYFCVKGIKTSAQVDQDTILEKVMKPLNNTMFNNQEWSFQQDSAPGHKARSTQSWLETNVSDFIRAEDWPSSSPDLNPLDYDLWSVLESTACSKHHDDLESLKQSVRLAVKKFPMERVRASIDNWPQRLKDCIAANGDHFE

Summary

Description
Tautomerization of L-dopachrome with decarboxylation to give 5,6-dihydroxyindole (DHI). Also catalyzes the tautomerization of the methyl ester of L-dopachrome and dopamine chrome. May play a role in melanization reactions during late pupal and adult stages. May play a role in melanization reactions during larval and early pupal stages.
Tautomerization of L-dopachrome with decarboxylation to give 5,6-dihydroxyindole (DHI). Also catalyzes the tautomerization of the methyl ester of L-dopachrome and dopamine chrome. May play a role in melanization reactions during late pupal and adult stages.
Major royal jelly protein 1: induces the differentiation of honeybee larvae into queens through an Egfr-mediated signaling pathway. Promotes body size increase by activating p70 S6 kinase, stimulates ovary development by augmenting the titer of vitellogenin (Vg) and juvenile hormone, and reduces developmental time by increasing the activity of mitogen-activated protein kinase and inducing the 20-hydroxyecdysone protein (20E). Most abundant protein found in the royal jelly which is the food of the queen honey bee larva. The royal jelly determines the development of the young larvae and is responsible for the high reproductive ability of the honeybee queen.
Jellein-1: has antibacterial activity against the Gram-positive bacteria S.aureus ATCC 6535, S.saprophyticus and B.subtilis CCT2471, and the Gram-negative bacteria E.coli CCT1371, E.cloacae ATCC 23355, K.pneumoniae ATCC 13883 and P.aeruginosa ATCC 27853, and antifungal activity against C.albicans. Lack cytolytic activity and does not induce rat peritoneal mast cell degranulation.
Jellein-2: has antibacterial activity against the Gram-positive bacteria S.aureus ATCC 6535, S.saprophyticus and B.subtilis CCT2471, and the Gram-negative bacteria E.coli CCT1371, E.cloacae ATCC 23355, K.pneumoniae ATCC 13883 and P.aeruginosa ATCC 27853, and antifungal activity against C.albicans. Lack cytolytic activity and does not induce rat peritoneal mast cell degranulation.
Jellein-4: lacks antibacterial and antifungal activity. Lacks cytolytic activity and does not induce rat peritoneal mast cell degranulation.
Catalytic Activity
L-dopachrome = 5,6-dihydroxyindole-2-carboxylate
Biophysicochemical Properties
0.33 mM for L-dopachrome
0.29 mM for dopamine chrome
0.11 mM for L-dopachrome
0.31 mM for dopamine chrome
Subunit
Is present in royal jelly in different forms: monomer (55 kDa), oligomeric subunit (ca. 420 kDa), and water-insoluble aggregates in sediment after interaction with fatty acids (Ref.7). Interacts with apisimin to form the heterooligomer apisin (350 kDa) (PubMed:27721892).
Miscellaneous
Exhibits a growth factor-like action on primary-cultured rat hepatocytes by stimulating DNA synthesis and protecting cells from apoptosis induced by serum deprivation. Also activates mitogen-activated protein kinase, as well as protein kinase B, a key regulator of cell survival (PubMed:16290177).
Degraded proportionally to the period of storage, and is completely lost during storage at 40 degrees Celsius for 30 days.
Similarity
Belongs to the major royal jelly protein family.
Keywords
Alternative initiation   Complete proteome   Glycoprotein   Isomerase   Melanin biosynthesis   Reference proteome   Secreted   Signal   Repeat   3D-structure   Amidation   Antibiotic   Antimicrobial   Developmental protein   Direct protein sequencing   Fungicide  
Feature
chain  L-dopachrome tautomerase yellow-f
splice variant  In isoform 2.
peptide  Jellein-2
EC Number
5.3.3.12
Pfam
PF03022   MRJP
Interpro
IPR011042   6-blade_b-propeller_TolB-like        + More
IPR017996   Royal_jelly/protein_yellow       
Gene 3D
PDB
5YYL     E-value=1.34725e-13,     Score=194

Ontologies

Topology

Subcellular location
Secreted  
Length:
3505
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0665299999999998
Exp number, first 60 AAs:
0.00051
Total prob of N-in:
0.00024
outside
1  -  3505
 
 

Population Genetic Test Statistics

Pi
18.824283
Theta
177.280433
Tajima's D
-1.630911
CLR
1.318635
CSRT
0.0456977151142443
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号