SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10565
Annotation
uncharacterized_protein_LOC101737203_precursor_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.007
 

Sequence

CDS
ATGTATAGTGCTAACCGAAACTTTAAATATGAGCGTAGTTGGAAATTATTTTCTTACGATATTGATGGAGTAAAATACACGAATGACTCGGATTACGAATACAAAGAAGGAACGTTCCAATTTCAGAACGTGGCCTTAGAGGATCATGAAAAGTTTCTAATAAGACAAAATCTGATTCCCTATAACTTTATTGATGATGTTATTCGAACAATAATAAGCATCCCGAGAACTCGTCCCGGAATTCCATTTACAGTAAACTATATTAATAACTTTGATAATGAAAAGGAGCTAGTACTGAGACCATTTCCTAATGCGAATGTTGGTAAAGAATTGATATCAGTTTTTACGATGGTTGAAGCAATTTGTTCTAGAATATGGTTTGTTGATACAGGATATCTGGATATCCCAGGTATAAGGAAGCAAGTTAAACCAGCGTCGTTGCTACTTTTTAATAAATATGAAGAACAACCGCAGTTCAGGAAAGACATCGACAATGCTTTTCTCCACAACGGTATCACTAGTGGACTGCGATCTCTATCAGTTGATTTTATATTACCGTGCTCCGAATCTTACGTATACATTACTGACGACACTACCCGCGACCTCATTGTCTTCTCGCTTCAGGACTTTCGTTTTACGAAAATCAGCCGCGCAAGTAATACGGCTGATTCTTGGAAATTTATGGTGCCACAGTTTGAAACACAATACAGGCTAGAAGTTGAAAAATATAGAAAAAGGCCGAATGAAACATACGAACACTATGTCGATTTTTTAAATTCTACAAATCAACTGTATGATCCAAAACGTGATTCAAGGCCTCGTGATACATTTAACAGCACGAACTATCCAAATTATGAAGGGATGCTATACACGAAAAATTATGATGGTGACATTTTGTTATTCACGGATTGGAATCGGTACAAGCTTTACTGTTGGAATATGGATACTCCATCTGAAGATAACAATGTTGATTGGCTCACAACAATCGATGAGAGTAAATATAGATTTGCAGCTCTAGATATGTCCGCTAGGATTTTTCGCGGACTAATGCAGAGAACTTTAAATAGCACGTCGTCAAAGTTCAATGAAGACGAATCCAATTTTTGGCTTTTCTCGAAGGACATTGACGAGTTGCTGGAGGGATCAAAATGCATAAATAACCGGTCCACGCATAAAATGACGCGGAGATCGACGCGTCAAACTATTATTTTTCAAAAGAATATGAAGAAAATGCGTACCTGA
Protein
MYSANRNFKYERSWKLFSYDIDGVKYTNDSDYEYKEGTFQFQNVALEDHEKFLIRQNLIPYNFIDDVIRTIISIPRTRPGIPFTVNYINNFDNEKELVLRPFPNANVGKELISVFTMVEAICSRIWFVDTGYLDIPGIRKQVKPASLLLFNKYEEQPQFRKDIDNAFLHNGITSGLRSLSVDFILPCSESYVYITDDTTRDLIVFSLQDFRFTKISRASNTADSWKFMVPQFETQYRLEVEKYRKRPNETYEHYVDFLNSTNQLYDPKRDSRPRDTFNSTNYPNYEGMLYTKNYDGDILLFTDWNRYKLYCWNMDTPSEDNNVDWLTTIDESKYRFAALDMSARIFRGLMQRTLNSTSSKFNEDESNFWLFSKDIDELLEGSKCINNRSTHKMTRRSTRQTIIFQKNMKKMRT

Summary

Pfam
PF03022   MRJP
Interpro
IPR011042   6-blade_b-propeller_TolB-like        + More
IPR017996   Royal_jelly/protein_yellow       
Gene 3D
PDB
5YYL     E-value=5.86901e-06,     Score=119

Ontologies

Topology

Length:
413
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.11595
Exp number, first 60 AAs:
0.00033
Total prob of N-in:
0.17719
outside
1  -  413
 
 

Population Genetic Test Statistics

Pi
60.025571
Theta
59.353896
Tajima's D
-0.684926
CLR
0.210945
CSRT
0.204139793010349
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号