SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10556
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.152 Nuclear   Reliability : 1.257
 

Sequence

CDS
ATGAATGATGGCAAACTTACAAAAAACATTACCCCAGGAGGGGAGACCCGCTCGGGGGAAGGGTGCACCGTCACCGGCGCCGTCATCGGCGTCGATGTCTGTCGCCTCGCTGGACGGGCGGACGACAGAAGAGGAGGAGGGCGGTCTTCGGGACCCTGCCTTGGTCATAGGCAGGGCCATGAAGACCGTCAAGTCGTATGCGGCGACCAGTGCCAAAACCAAAGCTGCTGGCCGCAGGCTGCGGGAAGTCGTCTCGCGAGTCTCGAAGGTTCGGTTGCTTCCGCCAATGACCAGGTGGTGCAGCTGATGGCGGAGAATTCGAGGCTCCGAGCACAGCTACAGGCGCAGCAGCGGCCCGATGGCAAGGTTGCTGCTACCAAGCGGGTAGCCGCGACGAGGTCGTCGCCCGCGTTGCCGCGTGCCGCTGGGTCGCGGACTCCTCCGGCATCTGTGCCGGCGGTGTCGCCGCTGGTCTCCGGGGTCCCTCGGGGTCCCTGTCCCTCAGCGGCGGCTGGCGACCCGTGGCCCGTGCTGCCACCATCGCGCGCGGTACAGTGGCGTTCGCGTCTCCCGTCGCCGCGGTCTAGGGAGGCGACGGCCGTCGAGCGGCAGCAGGGATCCGCGGGGCCACGGATCTTGGACCTGCCGGAACCGAATTGCTACAGCCTGGACGAGATTATCGACCGCACCGTCCAGGCTGTAATGGAAAGGCTGGGTGGCGGGCTGGCGGCTCTCGAGGCGAAGCGTGTTGTCTCTGGTGACGCTGAGCGGCCTGCGTCTACACCTGCCGCGGTGTTGGGTGCTGCGGTGACCCACTCCACCCCCGTACAGGCTCCAGCCACTAGGGCGGGCCCGGGGCGAGACAGAGCCAAGCGGGGGGGCGGCGCTAATGCGAAGTGCACATCGCAGGCGCCTCAACCCCGTCCGCTGCCTCCGCCCCCGTCTAACATGGACGAGGGGTGGAATGTGGTGGCCCGGCGGGGTGCCAAGAGGGCCGTACCGACAGCTCCGCAAGTGGACGGAGCACCGGCCACCGCGGTGTCTCAGGCTGCTCCCCAACAGGGTCGAGCGCCTGTGGCCGCCAAGAAAAAGAAGACGAAGAAGAAGTCGTCGCGCGCGCCGCGGTCGGCGGCAGTGGTCTTAACGCTGCTGCCGGCCGCCGAGGCCAAGGGCATGTCATACGGAGATGTAGTCTCCCGGGCGCGCGCGGCTATTGATCTGGACGAGATCGGGGCGGGGGAGGGCCTCCGCTGTAGGCTGACGGCCAATGGGGCCAAGCTACTAGAGTGTCCCGGTGCCGATAGTTCCGGCATCGCGGAGCGTCTGGCGGCGAAGCTCCGTACGGTTCTGCCTGAGGAGGAGGTTCGAGTGCCTGGCTCTGTTTGGGTGCGTTGCCCGGTAGAGGCGGCCACCTCCTTGGCTGCTCCTCCGCCCGGGAGACCGTCGGGGGAACCGGGCAGGTTGCGCGTGGGCTGGATAGCGGCCCGCGTGCACCTTCTCGAACCACGCGCCTGGCGGTGCCTCAGATGCTTCAGCACTGGGCACTGCCTCGTTAAATGCCGGATGACTGTTGGTTTGGGGACGTTGATGGCTTGGCGGCCATACATATCAGAAGAACCGCGATGGTCCTCCCCCCTGGCGATGGTGACCAGGGGCCCCGGGATCGTCGCGGTACAATTAGAGAATATCGTCGTGATCGGGGTGTACTTTTCTCCGAATCGGCCTACCGTCGAGTTCGAGCGGTTCCTGGACGGGCTAGAGGTGATCGCTCGTCAACTCGCTCCCCGTTCAGTGATACTGGCGGGGGACTTCAATGCGAAGTCTGTCGCTTGGGGTTCCCCATTCACGGACGCTCGTGGTAGGCTGCTGGAGGAGTGGGCGGTCGCGGTCGGTCTCTGTATCGTTAATAGGGGCTCGATCGCGACTTGCGTGCGGTGGACGGGCGAGTCTATCGTGGACTTGACGTTCGCGAGCTCGCCCGTCGCACGGCGCATCCTCGGCTGGAGAGTGGTGGTGGGGGCGGAATCGTTGTCCGATCACCGGTATATCCGGTACGATCTTTCTGCCCCCGCGCCGACGCCGGCTGCAGGTGCCCGCGAGGTTGACCCCCCGCAGAGTGCATCCCGGTCATTCCCTAGGTGGGCACTGAAGCTCCTGAACAGGGAGCTCCTGGTGGAGGCCTCTATGGTGGCGGCGTGGGCGCCCAAGCGCCCACAACCTGTCGATGTGGAAACCGAGGCCGAATGGTTCCGGGGCGCGATGCACCGCATATGTGATGCCTCGATGCCCCGGGTCGGCCCTCGGCATTCTGGACGGCGACAGTCGCCCTGGTGGTCGCCCGAAATTGCAAGACTGCGTGCGGTCTCCATTCGGGCGAGCCGCCGGTGCACTAGACACCGCCGTCGCCGCCGCCTGCGGCGCGACGAGCCTGTCGCGTTCGCGGAGGAGGAAGCTCGGCTGCACCGCGAATATCGCGCTGCGAAGGACGCCCTGCGGCTGGCCATCAGGCGGGCCAAGGAACAAAGCATGGAGAGACTCTTGGAGGCGCTCGAAGCGGATCCGTGGGGGAGCCCATACAAATTGGTACGCGGCAAGTTACGCCCGTGGGCCCCCTCTATGACTGAGCGCCTCCAGCCTCAGCAGCTGCAGGACATCGTTTCGGCGTTGTTCCCGCAGGAGCGGGAGGGTTTTGTCCCTCCCGCTATGGGCGGGCCGTCTGACACCGTCGACGGCCAAGCTCCTGCTGAGGTGCCCCGTATTACTGAGGCAGGGCTCCGGGTGGCCGTTGTCAAGATGACTGCGAGAGACACGGCCCCCGGCCCGGACGGAGTCCACGGCCGGGTATTGGCCTTGGCCCTCGGTGCCCTGGGGGACCGGCTCCTTGAGCTATATAATGGCTGCTTGGAGTCGGGACGGTTTCCGTCGCTCTGGCGGACGGGTAGACTTGTGTTGTTGAGGAAGGAGGGGCGCCCGGTGGATACAGCCGCTGGGTATCGTCCTATCGTACTGCTGGACGAGGCGGGAAAATTGCTGGAACGAATTCTGGCTGCCCGCATCGTTCAGCACCTGGTCGGGGTGGGGCCTGACCTGTCGGCGGAGCAGTACGGCTTCCGGGAGGGCCGTTCGACCGTGGATGCAATTCTTCGCGTGCAGTCCCTCTCGGACGAGGCCGTTTCTCGGGGTGGGGGGTCGGTTCTCGGCCCCCTCTTGTGGAATATCGGGTACGACTGGGTGCTGAGGGGCGCCCTCCTCCCGGGCCTCCGCGTTATTTGTTACGCGGACGACACGTTGGTCGTGGCCCGGGGGGATGATTATAGGGAGTCTGCCCGTCTCGCCACAGCGGGAGTGGCCCTCGTCGTCGGAAGGATAAGGAGGCTGGGTCTCGACGTGGTGCTCAATAAATCCGAGGCTCTGTGGTTTCACGGGCCGCGGGGGGCGCCACCCGTTGACACCCACATCGTGGTTGGAGGCGTCCGGATAGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCGTGTTGGACAGCCGGTGGGCTTTTCGTGCTCACTTTGCGGAGCTGGTCCCCCGATTGATGGGGACGGCCGGTTCTTTGAGCCGGCTGCTCCCGAATATTGGGGGACCGGATCAGGTTGTGCGCCGCCTCTACGCGGGGGTGGGTCATCCGCGGATATCGCACCGTCTCTTCGAGGCGGCGTGTGTTTTGGCGGGGACGCCGCCATGGGAGCTGGAGGCGGAGTCGCTCGCTGCCGACTATCGGTGGCGCAGCGAGCTTCGTGCTCGGGGCGTGGCGCGTGTCCCCGAAAGTGAGCTGCGGGCGCGGAAGGCCCATTCTCGGCGGTCCGTGCTCGAGTCGTGGTCGAGGCGATTGGCCAACCCCACGTGGGGGCTACGGACCGTCGAGGCGGTTTACCCGGTCTTTGATGACTGGGTGAATCGTGGCGAAGGACGTCTCACCTTTCGTCTGGTGCAGGTGCTGACCGGGCACGGATGCTTCGGGAAGTACCTGCGCCGGATAGGGGCTGAGCCGACGACGAGGTGTCACCATTGTGGACACGACCTGGACACGGTGGAGCATACGCTCGCTGTCTGCCCCGCTTGGGAGGTGCAGCGCCGTGTCCTGGTCGCAAAGATAGGACCTGACTTGTCGCTGCCTGGCGTCGTGGCGTCGATGCTTGGCAGCGATGAGTCATGGAAGGCATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGAGTGA
Protein
MNDGKLTKNITPGGETRSGEGCTVTGAVIGVDVCRLAGRADDRRGGGRSSGPCLGHRQGHEDRQVVCGDQCQNQSCWPQAAGSRLASLEGSVASANDQVVQLMAENSRLRAQLQAQQRPDGKVAATKRVAATRSSPALPRAAGSRTPPASVPAVSPLVSGVPRGPCPSAAAGDPWPVLPPSRAVQWRSRLPSPRSREATAVERQQGSAGPRILDLPEPNCYSLDEIIDRTVQAVMERLGGGLAALEAKRVVSGDAERPASTPAAVLGAAVTHSTPVQAPATRAGPGRDRAKRGGGANAKCTSQAPQPRPLPPPPSNMDEGWNVVARRGAKRAVPTAPQVDGAPATAVSQAAPQQGRAPVAAKKKKTKKKSSRAPRSAAVVLTLLPAAEAKGMSYGDVVSRARAAIDLDEIGAGEGLRCRLTANGAKLLECPGADSSGIAERLAAKLRTVLPEEEVRVPGSVWVRCPVEAATSLAAPPPGRPSGEPGRLRVGWIAARVHLLEPRAWRCLRCFSTGHCLVKCRMTVGLGTLMAWRPYISEEPRWSSPLAMVTRGPGIVAVQLENIVVIGVYFSPNRPTVEFERFLDGLEVIARQLAPRSVILAGDFNAKSVAWGSPFTDARGRLLEEWAVAVGLCIVNRGSIATCVRWTGESIVDLTFASSPVARRILGWRVVVGAESLSDHRYIRYDLSAPAPTPAAGAREVDPPQSASRSFPRWALKLLNRELLVEASMVAAWAPKRPQPVDVETEAEWFRGAMHRICDASMPRVGPRHSGRRQSPWWSPEIARLRAVSIRASRRCTRHRRRRRLRRDEPVAFAEEEARLHREYRAAKDALRLAIRRAKEQSMERLLEALEADPWGSPYKLVRGKLRPWAPSMTERLQPQQLQDIVSALFPQEREGFVPPAMGGPSDTVDGQAPAEVPRITEAGLRVAVVKMTARDTAPGPDGVHGRVLALALGALGDRLLELYNGCLESGRFPSLWRTGRLVLLRKEGRPVDTAAGYRPIVLLDEAGKLLERILAARIVQHLVGVGPDLSAEQYGFREGRSTVDAILRVQSLSDEAVSRGGGSVLGPLLWNIGYDWVLRGALLPGLRVICYADDTLVVARGDDYRESARLATAGVALVVGRIRRLGLDVVLNKSEALWFHGPRGAPPVDTHIVVGGVRIGVGVQLKYLGLVLDSRWAFRAHFAELVPRLMGTAGSLSRLLPNIGGPDQVVRRLYAGVGHPRISHRLFEAACVLAGTPPWELEAESLAADYRWRSELRARGVARVPESELRARKAHSRRSVLESWSRRLANPTWGLRTVEAVYPVFDDWVNRGEGRLTFRLVQVLTGHGCFGKYLRRIGAEPTTRCHHCGHDLDTVEHTLAVCPAWEVQRRVLVAKIGPDLSLPGVVASMLGSDESWKACSTSASAPSRRRRRRGE

Summary

Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
Interpro
IPR001878   Znf_CCHC        + More
IPR036875   Znf_CCHC_sf       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
SUPFAM
SSF57756   SSF57756        + More
SSF56219   SSF56219       
Gene 3D
PDB
1WDU     E-value=4.29005e-11,     Score=169

Ontologies

Topology

Length:
1416
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0310899999999999
Exp number, first 60 AAs:
0.00315
Total prob of N-in:
0.00037
outside
1  -  1416
 
 

Population Genetic Test Statistics

Pi
2.332779
Theta
119.183563
Tajima's D
2.601363
CLR
0.000644
CSRT
0.951652417379131
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号