SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10545
Annotation
Uncharacterized_protein_OBRU01_15802_[Operophtera_brumata]
Location in the cell
Nuclear   Reliability : 2.762
 

Sequence

CDS
ATGGATCTGTACACTAAGTTACAAGAGGTGGAATCAAGCGTTGTGCAGAGGATGACTGAGTTTGAAGCAATGCTGAGCAGTCACCAGTCACCACACACGGACCTAGGCAAGTTGTCACAAGATTTCATCGCATTCCGGAATCTCACACTACAAACACTCAACATGCTGAGGTCACAGATGGAGCTTGTTCTCTTGGGGTTGGACAGGCATGAGATGGCGTCGCGTCGTAAGGTCCTTCTGTTTCATGGAATCCCGGAGTCAGATGCCACAGACCCAGCAACAGCAATTGTGGGTATATTAACCAACCAAATGAAGGTGGCTGGTTGCACAGAAGAGGACTTAACTGCTTGCTATCGGTTAGGCTCCAACACCAATAAGCCTAGGCCTATATTAGTCAGGTTCATGAGTTTGAGGCGATGCAATGAAGTGTGGAAGAACAAGACACTCCTGAAGGGTTCTAGGGTCATCATTTCAGAATTTCTGACCAAATCACGTCATGATGTCTTTTTGGAGGCCCGCTCTCATTTCGGCGTTAAGCGCTGCTGGACAACAGATGGGAAAATAATCGTCCTTCTCCCGGATAATAAACGCAGTAAGATTGAACAGATGTTTGAACTTCAGCATCTGAAAACCAAGTTTCCCTCGGCTCAAAAAGCGCAAGGAGCTCCTCAGTCATCTGGGAAATCTCATGACGAACCCAAGACGGCACCAAAATCAGCGGCAGAGCGAGAAATCGGCAAGAGGACGACTCGTCGAAAGTAG
Protein
MDLYTKLQEVESSVVQRMTEFEAMLSSHQSPHTDLGKLSQDFIAFRNLTLQTLNMLRSQMELVLLGLDRHEMASRRKVLLFHGIPESDATDPATAIVGILTNQMKVAGCTEEDLTACYRLGSNTNKPRPILVRFMSLRRCNEVWKNKTLLKGSRVIISEFLTKSRHDVFLEARSHFGVKRCWTTDGKIIVLLPDNKRSKIEQMFELQHLKTKFPSAQKAQGAPQSSGKSHDEPKTAPKSAAEREIGKRTTRRK

Summary

EMBL
JTDY01004815    JTDY01001265    KOB67717.1    KOB74342.1    NWSH01000709    PCG74665.1    + More
ODYU01005692    SOQ46801.1    NWSH01001172    PCG72268.1    JTDY01004162    KOB68510.1    NWSH01002122    PCG69097.1    KZ150113    PZC73314.1    NWSH01000981    PCG73266.1    KZ150731    PZC70355.1    KZ149998    PZC75357.1    NWSH01004248    PCG65306.1    JTDY01000147    KOB78598.1    JTDY01015832    KOB51930.1    JTDY01004770    KOB67785.1    ODYU01006869    SOQ49099.1    NWSH01000964    PCG73374.1    JTDY01001444    KOB73845.1    ODYU01012456    SOQ58773.1    NWSH01008089    PCG62701.1    KZ150083    PZC73827.1    NWSH01000574    PCG75564.1    NWSH01000800    PCG74117.1    NWSH01002863    PCG67420.1    NWSH01000512    PCG75926.1    NWSH01001465    PCG71162.1    PCG71163.1    NWSH01000695    PCG74738.1    ODYU01003266    SOQ41795.1    BABH01019446    BABH01019447    BABH01019448    BABH01019449    BABH01019450    JTDY01007405    KOB65227.1    KOB73846.1    JTDY01009601    KOB63242.1    JTDY01005020    KOB67468.1    JTDY01010801    JTDY01009435    KOB57999.1    KOB63512.1    JTDY01002460    KOB71369.1    NWSH01001639    PCG70611.1    NWSH01000281    PCG77797.1    KZ149916    PZC77943.1    JTDY01016995    KOB51870.1    KZ150737    PZC70349.1    JTDY01009052    KOB64154.1    ODYU01010789    SOQ56106.1    JTDY01010087    KOB61249.1    KOB61251.1    RSAL01001827    RVE40669.1    NWSH01004711    PCG64730.1    JTDY01000235    KOB78128.1    GEZM01088631    JAV58061.1    GEZM01088632    JAV58060.1    JTDY01000521    KOB76815.1    MRZV01000060    PIK60325.1   
Pfam
PF00027   cNMP_binding        + More
PF01582   TIR
PF14529   Exo_endo_phos_2
Interpro
IPR004244   Transposase_22        + More
IPR000595   cNMP-bd_dom       
IPR014710   RmlC-like_jellyroll       
IPR018490   cNMP-bd-like       
IPR035897   Toll_tir_struct_dom_sf       
IPR000157   TIR_dom       
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
SUPFAM
SSF51206   SSF51206        + More
SSF52200   SSF52200       
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
253
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01112
Exp number, first 60 AAs:
0.00399
Total prob of N-in:
0.17620
outside
1  -  253
 
 

Population Genetic Test Statistics

Pi
25.878665
Theta
22.832786
Tajima's D
-1.06777
CLR
1.238156
CSRT
0.125143742812859
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号