SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10534
Annotation
gag-like_protein_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.797
 

Sequence

CDS
ATGGAGGAAAAACTTTTCATCGACTTCATTCGGGAAAAATATCCGTCAATCGCGCCCGAATTCGAAGCCTATAGGGCCTCATTTGGTAATTATTCTACCCCCGCATCTCTCGCCGCCGTCGCCAAACATGCCTCGCAGGCATGCCTCGCGTGCCCCGCCGCCGGTCCGTGTTCAAGCGCACGTACGCACGCCGCCGCCGTAGCGTCTAACGCCCCCGTCCCCGCTACCCCCGCGCCCGCGTCAATCACGTCAGTTTCGTCCGTCGCGACCTCAATAGCGTCTAGTTCAGGCTCCGATACCGAATCGGAGATGGACTTCGAGTCCGCAACTAGCCCTCAACCCGGAACCTCGGATGGGTTCCAAACTGTAACGCGCGGTAAAAAGCGTACTCGCGTCGTGGAGTCCCGGAGCTCCATGACGAAGCAAACCAAGTCCGCGACCGCCTCCCGACCGCAGGTAGTCGTAACGCCGGAGTCGGACTCCGCCCGCCGCGTAATCCCACCGCCGCGCCCAAAAACCGCGCCCGCGCCTAAAACAATTGTCCCGCCCCCGCTGATACTCCAGGAGAAGTCAGCGTGGAATCGCGTATCCCAGGCCCTTCAGGCCAACAAAATTAATTATACCCATGCGCGTAACGTCGCGCATGGGATTCAGATTAAGGTCGCAACGCCGGGCGACCATAGGGCCCTCTCTTCTTACCTCCGAAAGGAGAACATAGGTTATCACACCTATGCTCTTCAGGAGGACCGCGAACTCCGCGTAGTGATACGTGGAGTCCCCAAGGAACTCGACATAGACTACGTAAAGGAGGATTTGATCGGTCAGTCCCTCCCAATAATTAGTGTGCACCGGATGCACAGCGGACGCGGCAGACAGCCGTACAATATGATTCTCGTCGCGCTAGAATCAACCCCGGAGGCAAAGAAAAGAATCTCATGTCTCAAAACGATATGCGGCCTCTCCGGGGTCACCATCGAAGCCCCCCATAAACGTGGTACTCCCGGGCAGTGCCACAGGTGCCAGCTCTATGGCCACTCAGCGCGTAATTGCCACGCGCGCCCCCGCTGCGTGAAATGCCTCGGCGATCACACAACCACAGAATGTTCGCGTGTTAGGGAAACCGCGACGGAACCCCCAAGCTGTGTCCTATGCCTTAAGCAAGGGCACCCGGCAAACTACCGCGGATGTCCTAGGGCTCCGCGTAAACGCCTGAACCACCCAGCCCCCCGAACCGTCGACCCAAAGACTTCGGCGCCTTCAGTGCCGAAACCAGCCTTCGTACCGGCTGCGGTTCCCACCGTCTCGGCGTGGAAAAAACCGCTGCCGTATACGAAGGAGGGAACACAAAACGTACCCCAGCTCCCGCCTGCGACACGTCACGCGCCTCAGCCCCTGCTCGCACCTCGCCCCGCGCCCGCGTACCGCCCCCCGCAACCCTCAGTCGTCAACGACTTCGCGCTCGTGCGCGACTTCGTCACCGCGGTAAACTTTGACCGTCTGCGATCGTTCGCAGATGCTATCCGTAGGTCGGTAACCCCCGAACAGCGGCTCGCGGCCGCTTTCGATCACATGGACGTCTACGAGTCCGTGTCTCGCACGTTATAA
Protein
MEEKLFIDFIREKYPSIAPEFEAYRASFGNYSTPASLAAVAKHASQACLACPAAGPCSSARTHAAAVASNAPVPATPAPASITSVSSVATSIASSSGSDTESEMDFESATSPQPGTSDGFQTVTRGKKRTRVVESRSSMTKQTKSATASRPQVVVTPESDSARRVIPPPRPKTAPAPKTIVPPPLILQEKSAWNRVSQALQANKINYTHARNVAHGIQIKVATPGDHRALSSYLRKENIGYHTYALQEDRELRVVIRGVPKELDIDYVKEDLIGQSLPIISVHRMHSGRGRQPYNMILVALESTPEAKKRISCLKTICGLSGVTIEAPHKRGTPGQCHRCQLYGHSARNCHARPRCVKCLGDHTTTECSRVRETATEPPSCVLCLKQGHPANYRGCPRAPRKRLNHPAPRTVDPKTSAPSVPKPAFVPAAVPTVSAWKKPLPYTKEGTQNVPQLPPATRHAPQPLLAPRPAPAYRPPQPSVVNDFALVRDFVTAVNFDRLRSFADAIRRSVTPEQRLAAAFDHMDVYESVSRTL

Summary

Pfam
PF07530   PRE_C2HC
Interpro
IPR006579   Pre_C2HC_dom       
ProteinModelPortal

Ontologies

GO

Topology

Length:
534
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00049
Exp number, first 60 AAs:
0.00033
Total prob of N-in:
0.00036
outside
1  -  534
 
 

Population Genetic Test Statistics

Pi
0.922709
Theta
1.69234
Tajima's D
-0.780647
CLR
0
CSRT
0.178841057947103
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号