SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10504
Annotation
PREDICTED:_uncharacterized_protein_LOC101737183_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.086 Mitochondrial   Reliability : 1.26
 

Sequence

CDS
ATGGGCGGGCCGTCTGACACCGTCGACGGCCAAGCTCCTGCTGAGGTGCCCCGTATTACGGAGGCAGAGCTCCGGGTGGCCGTTGTCAAGATGACTGCGAAAGACACGGCCCCCGGCCCGGACGGAGTCCACGGCCGGGTATTGGCCTTGGCCCTCGGTGCCCTGGGGGACCGGCTCCTTGAGCTATATAATGGCTGCTTGGAGTCGGGACGGTTTCCGTCGCTCTGGCGGACGGGTAGACTTGTGTTGTTGAGGAAGGAGGGGCGCCCGGTGGATACAGCCGCCGGATATCGTCCTATCGTGCTGCTGGACGAGGCGGGAAAATTGCTGGAACGTATTCTGGCTGCCCGCATCGTTCGGCACCTGGTCGGGGTGGGGCCTGACCTGTCGGCGGAGCAGTACGGCTTCCGGGAGGGCCGTTCGACCGTGGATGCAATTCTTCGCGTGCGGTCCCTCTCGGACGAGGCCGTCTCTCGGGGTGGGGTGGCGCTGGCGGTGTCTCTTGACATCGCCAACGCATTTAACACTCTGCCCTGGACCGTGATAGGGGGGGCACTGGAGAGGCATGGAGTGCCCCTCTACCTCCGCCGGCTGGTTGGGTCCTATTTGGGGGCCAGGTCGGTCGTATGTACCGGGTACGGTGGGACCCTTCATCGCTTTCCGGTCGTGCGTGGTGTTCCGCAGGGGTCGGTTCTCGGCCCCCTCTTGTGGAATATCGGGTACGACTGGGTGCTGAGGGGCGCCCTCCTCCCGGGCCTCCGCGTTATTTGTTACGCGGACGACACGTTGGTCGTGGCCCGGGGGGATGATTTTAGGGAGTCTGCCCGTCTCGCCACAGCGGGAGTGGCCCTCGCCGTCGGAAGGATAAGGAGTCTGGGTCTCGACGTGGCGCTCAGTAAATTCGAGGCTCTGTGGTTTCACGGGCCGCGGAGGGCGCCACCAGTTGACACCCACATCGTGGTTGGAGGCGTCCGGATAGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCGTGTTGGACAGCCGGTGGGCTTTTCGTGCTCACTTTGCGGAGCTGGTCCCCCGATTGATGGGGACGGCCGGTTCTTTGAGCCGGCTGCTCCCGAATATTGGGGGACCGGATCAGGTTGTGCGCCGCCTCTACGCGGGGGTGGTGCGATCGATGGCCCTGTACGGTGCACCTGTGTGGGCTGAGCCGCGCAACCGGGCCACTATGGCTCGGTTTCTGCGCCGGCCGCAGCGCACCGTTGCCATCAGGGTCATCCGCGGGTATCGCACCGTCTCCTTCGAGGCGGCGTGTGTTTTGGCGGGGACGCCGCCATGGGAGCTGGAGGCGGAGTCGCTCGCTGCCGACTATCGGTGGCGCAGCGAGCTCCGTGCTCGGGGCGTGGCGCGTGTCCCCGAGAGTGAGCTGAGGGCGCGGAAGGCCCATTCTCGGCGGTCCGTGCTCGAGTCGTGGTCGAGGCGATTGGCCAACCCCACGTGGGGGCTACGGACCGTCGAGGCGGTTTACCCGGTCTTTGATGACTGGGTGAATCGTGGCGAAGGACGTCTCACCTTTCGTCTGGTGCAGGTGCTGACCGGGCACGGATGCTTCGGGAAGTACCTGCGCCGGATAGGGGCTGAGCCGACGACGAGGTGTCACCATTGTGGACACGACCTGGACACGGCGGAGCATACGCTCGCTGTCTGCCCCGCTTGGGAGGTGCAGCGCCGTGTCCTGGTCGCAAAGATAGGACCTGACTTGTCGCTGCCTGGCGTCGTGGCGTCGATGCTTGGCAGCGATGAGTCATGGAAGGCTATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGAGTGAGGGAAAGCTCTCCTCACTACGCAGAAACCCGCCGCCGCCGAGCAGGGGGTCGGGACCGGGGTCGTATCCGTGACCTGGCCCCCTAA
Protein
MGGPSDTVDGQAPAEVPRITEAELRVAVVKMTAKDTAPGPDGVHGRVLALALGALGDRLLELYNGCLESGRFPSLWRTGRLVLLRKEGRPVDTAAGYRPIVLLDEAGKLLERILAARIVRHLVGVGPDLSAEQYGFREGRSTVDAILRVRSLSDEAVSRGGVALAVSLDIANAFNTLPWTVIGGALERHGVPLYLRRLVGSYLGARSVVCTGYGGTLHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLRVICYADDTLVVARGDDFRESARLATAGVALAVGRIRSLGLDVALSKFEALWFHGPRRAPPVDTHIVVGGVRIGVGVQLKYLGLVLDSRWAFRAHFAELVPRLMGTAGSLSRLLPNIGGPDQVVRRLYAGVVRSMALYGAPVWAEPRNRATMARFLRRPQRTVAIRVIRGYRTVSFEAACVLAGTPPWELEAESLAADYRWRSELRARGVARVPESELRARKAHSRRSVLESWSRRLANPTWGLRTVEAVYPVFDDWVNRGEGRLTFRLVQVLTGHGCFGKYLRRIGAEPTTRCHHCGHDLDTAEHTLAVCPAWEVQRRVLVAKIGPDLSLPGVVASMLGSDESWKAMLDFCECTISQKEAAGRVRESSPHYAETRRRRAGGRDRGRIRDLAP

Summary

EMBL
AB090825    BAC57926.1    AB078931    BAC06456.1    AB078930    BAC06454.1    + More
AB078935    BAC06462.1    AB078929    BAC06452.1    KZ149896    PZC78733.1    LBMM01012027    KMQ86470.1    D85594    BAA19776.1    KQ460685    KPJ12887.1    RSAL01000481    RVE41577.1    LBMM01006954    KMQ90166.1    LBMM01004272    KMQ92618.1    LBMM01006671    KMQ90407.1    LBMM01007036    KMQ90099.1    LBMM01006657    KMQ90417.1    RSAL01003504    RVE40273.1    LBMM01005733    KMQ91252.1    LBMM01019839    KMQ83438.1    LBMM01008682    KMQ88705.1    LBMM01005948    KMQ91066.1    LBMM01002052    KMQ95336.1    LBMM01006063    KMQ90967.1    LBMM01019838    KMQ83439.1    LBMM01008448    KMQ88867.1    LBMM01004634    KMQ92224.1    LBMM01002480    KMQ94776.1    LBMM01015018    KMQ84954.1    LBMM01008422    KMQ88894.1    LBMM01003988    KMQ92922.1    LBMM01007425    KMQ89740.1    LBMM01003575    KMQ93366.1    LBMM01015025    KMQ84953.1    LBMM01003245    KMQ93755.1    LBMM01012412    KMQ86235.1    LBMM01008278    KMQ89009.1    LBMM01006725    KMQ90373.1    LBMM01005465    KMQ91492.1    KMQ94772.1    LBMM01004505    KMQ92346.1    LBMM01014122    KMQ85315.1    GGMR01014195    MBY26814.1    GGMR01000779    MBY13398.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    GFXV01002090    MBW13895.1    ABLF02011238    LBMM01005474    KMQ91485.1    GGMR01015159    MBY27778.1    GGMR01004600    MBY17219.1    LBMM01014956    KMQ84982.1    LBMM01005216    KMQ91703.1    ABLF02041886    ABLF02059310    GGMR01011682    MBY24301.1    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    ABLF02005203    ABLF02041316    GGMR01006838    MBY19457.1    LBMM01004262    KMQ92649.1    GGMR01015354    MBY27973.1    ABLF02013358    ABLF02013361    ABLF02054869    KU543683    AMS38371.1    LBMM01004261    KMQ92650.1    ABLF02034925    ABLF02004854    ABLF02041317    ABLF02011183    ABLF02041884    ABLF02023257    ABLF02018942    ABLF02041885    GGMR01019493    MBY32112.1    ABLF02010223    GFXV01003903    MBW15708.1    ABLF02004597    ABLF02041324    GGFL01001583    MBW65761.1    GGMR01012748    MBY25367.1    ABLF02007989    GGFJ01001727    MBW50868.1    GGFJ01001439    MBW50580.1    GGFJ01001369    MBW50510.1    ABLF02018808    GAKP01002292    JAC56660.1    AB593321    BAK38639.1    ABLF02009991    ABLF02009992    ABLF02054952    GALX01004785    JAB63681.1    ABLF02041557    ABLF02014650    GGFJ01001370    MBW50511.1    KQ971309    EEZ99146.1    APGK01005465    KB736249    ENN83233.1    LBMM01015285    KMQ84870.1    AB593327    BAK38648.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF07776   zf-AD
PF00096   zf-C2H2
PF01421   Reprolysin
PF00098   zf-CCHC
PF12017   Tnp_P_element
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR021896   Transposase_37       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=5.73355e-05,     Score=113

Ontologies

Topology

Length:
646
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0399800000000002
Exp number, first 60 AAs:
0.00071
Total prob of N-in:
0.00122
outside
1  -  646
 
 

Population Genetic Test Statistics

Pi
2.030356
Theta
19.487486
Tajima's D
1.128387
CLR
402.749716
CSRT
0.701264936753162
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号