SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10500
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon BS       + More
Probable RNA-directed DNA polymerase from transposon X-element      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 1.901
 

Sequence

CDS
ATGGTCAGGAACGACAGGCTTACTGCTCGTGGTGGTGGTACCGTCATTTACTATAGACGAGCCCTGCACTGCGTCCCTCTCGACCCCCCCGCGCTTTCTAACATCGAAGCATCAGTATGCCGAATCTCACTGACTGGACACGCGCCGATCGTTATCGCGTCCGTCTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGCATGGGAAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACGTCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGCGTTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAACCCGGACTCTACCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGATCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGCCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCGTCGATCCGCGCCTACGATAGGTATCCTACCGTGGATAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAAGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTACTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTAGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCGGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCTAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAGCCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGATCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATATACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAATCTGGCACAATGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGTACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCACAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCTCACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCTGTCGGGGCTCCGTGGTTCATGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCAATTCGGAAATATGAAATATGA
Protein
MVRNDRLTARGGGTVIYYRRALHCVPLDPPALSNIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHVRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFNPDSTPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLPDDIRELLRAKNASIRAYDRYPTVDNRIRMRALQRDVKSRIAEVRDARWSDFLERLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLIYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKIWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSSRISSRIRRRNLTPPITLFRQPIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFMRNVDLHDDLGLESIRKYEI

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
At least 30 copies of X-element are present in the genome and some elements are polymorphic between different strains.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon BS
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB055391    BAB21761.1    AB018558    BAA76304.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    GALX01005299    JAB63167.1    GALX01005359    JAB63107.1    KQ971729    KYB24751.1    ABLF02042518    ABLF02057746    GGMR01018716    MBY31335.1    GBBI01004395    JAC14317.1    ABLF02008153    ABLF02008462    ABLF02008464    GGMS01006359    MBY75562.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    NEVH01006736    PNF36716.1    ABLF02024246    GFTR01008262    JAW08164.1    GBBI01004571    JAC14141.1    GFTR01008279    JAW08147.1    GGMS01002992    MBY72195.1    GFTR01008038    JAW08388.1    ABLF02034467    NEVH01011985    PNF31054.1    NEVH01009134    PNF33528.1    NEVH01027074    PNF13841.1    NEVH01021205    PNF19912.1    GEZM01053022    JAV74219.1    ABLF02028535    ABLF02028545    GGMR01019198    MBY31817.1    GGMR01003407    MBY16026.1    ABLF02041767    GGMR01000676    MBY13295.1    NEVH01022639    PNF18527.1    GFTR01008151    JAW08275.1    GFTR01008271    JAW08155.1    GFTR01008256    JAW08170.1    GFTR01008251    JAW08175.1    GFTR01008261    JAW08165.1    NEVH01017470    PNF24199.1    GGMS01017365    MBY86568.1    GEZM01084969    JAV60363.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    LBMM01013518    KMQ85605.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    NEVH01020940    PNF20481.1    GECL01003538    JAP02586.1    ABLF02029306    ABLF02029314    ABLF02060138    GGMR01000226    MBY12845.1    GFXV01000908    MBW12713.1    NEVH01016302    PNF25823.1    ABLF02023911    RPOV01000134    RPJ78669.1    S59870    AAB26437.2    GFTR01008257    JAW08169.1    GGMR01016905    MBY29524.1    GGMR01003864    MBY16483.1    GGFL01004957    MBW69135.1    KK119692    KFM76444.1    NWSH01007753    PCG62823.1    KK119261    KFM75202.1    GGFL01005012    MBW69190.1    GBBI01003810    JAC14902.1    GGMS01002955    MBY72158.1    GFTR01008246    JAW08180.1    GBGD01000415    JAC88474.1    GGFJ01001857    MBW50998.1    GGMS01000737    MBY69940.1    GGFJ01001858    MBW50999.1    NEVH01026386    PNF14434.1    ABLF02040174    ABLF02040183    ABLF02055266    GGFJ01001822    MBW50963.1    KU543685    AMS38375.1    GGMR01006408    MBY19027.1    NWSH01000032    PCG80496.1    GFTR01008260    JAW08166.1    GGMR01012305    MBY24924.1    NEVH01005277    PNF39135.1    GGFJ01001844    MBW50985.1    AY060438    AAL25477.1    AF237761    AAF81411.1    GGFJ01001843    MBW50984.1    GGFJ01001842    MBW50983.1    NEVH01019963    PNF22185.1    GFTR01008269    JAW08157.1    GBGD01000389    JAC88500.1    GGMR01013409    MBY26028.1    NEVH01023280    PNF18085.1    GFXV01002840    MBW14645.1    AF456125    AAL57609.1    KU543673    AMS38352.1    ABLF02014118    ABLF02014121    ABLF02054790    GGMR01004661    MBY17280.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF07727   RVT_2
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
816
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
3.74725
Exp number, first 60 AAs:
0.06424
Total prob of N-in:
0.04767
outside
1  -  816
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
1.222572
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号