SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10438
Pre Gene Modal
BGIBMGA006890
Annotation
PREDICTED:_uncharacterized_protein_K02A2.6-like_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 4.022
 

Sequence

CDS
ATGGCAACAAATAACAACGAAGCAGTCTCCGGTATTAAACCACCCGGATACTTGCACATCGAGTCGGACAACAAGTCGGCAAATTGGAAAAAATGGCGACAACAGTTCGAATGGTATGCAACAGCAATTCAGCTAGGAAAGAAACCTGCCGATATTCAAGCTGCAACATTCATGTCAATCATAGGACCAGATGCAATTGACATCTACAACAGTTTTAATTTGAATACAATAGACGAACAAAAATTAAGCATCATTATCGGAAAGTTCGAAGAATATTTCGCGCCGAAAAACAACATATCGTTCGAAAGGTATGTTTTCTTCAAAATTGAACAACATGAAGACGAATCGTTTAACGAATTCATCACTAGAATTAAAACACAAGCAAACAAATGCGAGTTTGGCACTCTACTTGAAGAAATGCTAAAAGACAAGATTGTATTCGGAATAAAATCAACCCAAATCAGAGAAAAATTACTCACCGAAGAAAAACTTGATCTCACAAAAGCCACAGCCATCTGTAAAAGCAGTGAACAAGCCTCCAAACAACTTAATGAGTTTGAGAATAACAACAAGAGTGAAAAAATACTGACAATCAAAAGTAAGAACTTCAGAAATGAAAAATTTGACTGTAAAAGATGTGGTTCAAACCACAAGGCTAGAGAATGCCAAGCCTACAACAAATTATGCACAAAGTGTAACAAGGCCGGTCATTTTGCAAAAATGTGTCGTTCCAAAATCCAATTGAAACAAAAAAATAAAATAAATACTCTAGAAGAAAATTCTACTTCAGAAAATTCAGATGAATCATTTATAGGACAATTAAGTGTCGGCAACTCCAAAGATTGGACAGAAAGTGTCGAAACTGCCAACACCAAATTCACAGCAAAGCTTGATACTGGTGCAGAGTGCAACGTCCTTCCAAATTTCATAGTACAGAAAACTCACGCTTGTATACAACCAAGTCGCACTAAAAATTTAATAAGTTATTCAAATAACAGAATTTCAGTACTTGGAGAAGTAAAGTTACAATGCAAAATAAAAAAGAAAACTGCTAAAATACTATTTAAAGTTGTAGCTGAAAGAGTCACACCAGTCTTAGGACTAAACACTTGTGAGAAGCTGGGACTAATTGCACGAGTTGAAACATTGAAAGAAAGCTCATCCAATGATGACATATTTAAAGGGTTAGGTTGCTACAAAAATTTTGAGTATGATATTGACCTCATAGAAAACCCCAAATTTGAAATAAAACCAACAAGAAAAGTTCCACATGCCATAAGAAATGAAGTAAAACAAGAATTAGATAGAATGGTAAAACTGGATGTCATCACACCTGAAACAGAACCGACACCAGCAAAGGAAGAGCTACAGAAAACGGTCAAAGAAGTAATAGAGACATTGAAAATTTCTGGCTTCAAACTCAATCAAAGCAAATGCATCTTTGAAGCCAAAAGAATAAAATTTTTGGGTCATATAGTCTCAGCCAAAGGTTTAGAAGCAGATCCTGAAAAAGTAAAAGCCATAGAATTCATGAAAACACCACAGAACAAAAAAGAACTGCAAAGGATACTAGGAATGATAACATATTTAAATAAATACATTCCCAACATGTCAGAATTAACAAACCCTTTGAGAGACCTACTTCACAAGGACACAAGTTTCAACTGGGAATTCTATCATGATGAAGCACTCAACAAAATTAAAAAAGTCTTACAGAATCCACCAGTGCTAAAACTATATGATGAAGAAGACCTGAAGATCTCAATAATATTACCAACAACATTTGACTACACAGAAGAGTTGATCAAAGCAACAAAAGAAGACCCCCACCTGCAACTCTTGTTAAAAACAATAATGAAAGGGTTCCCAGAAAAGGCTGATCAACTCCCTACAGAACTGCATCACTACTTCAATTTCAAAGAAGAACTAACATACTTCAAAGGTCTAATTTTCAAAGGTTACAAAATTGTAGTGCCCAAAACACAAATACCTCAGATGCTAAAATACATACACCAAGGTCACCTTGGAATTCAGAGTTGCTTGAAAAGAGCACACCAATTACTCTATTGGAGAGGACAATATGAAGACATTGTGAAACTGGTTAGAAGCTGCTCAGCATGTGAAAAAACACAAAAGGACAATACCAACTATACCGTAGCAGTCAAAAGAATCCCATCTCTCCCATGGCAGATTGTGGCATCTGATCTATTTGAACTAAAAGGAAAACAGTATATTGTAATCTGTGACAGCTATTCAGGATACTTAGACTTTCAGTCACTTAAGAGCTCATCGTCAACTGAAGTGATTAATCACTTAAAACAATGGTTCTCTACACATGGAATACCTGAAGTACTTGAATCAGACAACGGTCCACAGTACATGTCCAGAGAATTCAAAAATTTCCAGAAAGAATGGCGTTTCACGCACTCAACATCCAGTCCTCACCACCCCCAAGGCAATGGCTTAGCCGAAAGAGCTATCCAAACTGCAAAAAACCTACTAAGGAAATGCAGTATTGATAAATCGGATATCCAACTTGCTCTATTAAATTGGAGAAATACACCAAGAACAAACAATCTAGGGTCTCCTAATCAACGCCTCTACAGTAGAATAACACGATCATTAATACCTACAAGTGAAAATAATCTTAAACCAAAGATAGTTCAAGGGGTCACATCTGAACTAAAAATCAGACACAAAGTCGGTCATCGTCAATGGGAAGGAGCGAGAGTGATAGAAAAACCTAATGATCACCCGAGATCCATTATCATTAAAACCGACAAAGGACAAATATTCAGAAGAAACATTGGACACATACACAATACACTATCAGACCTATCAATTGGCAGCAAAGAAGCGGTTCCGGAAACAGTATATCCTGACGACTTACCACATGCCCAATCGGACAAACAACCGGAGCTACCTGCAGCAGCTACTACATCTCAAGAACAAACAACTACATCACCAAGGATTAATTGCAAAAGCAGCGCTTCAGAAGCACCCGTCATAACTAGCAGTGATCAACCGACTACAAGATGTTCAAGATTTGGAAGAACCATCAAACCAGTCGACAGACTAGATCTATAG
Protein
MATNNNEAVSGIKPPGYLHIESDNKSANWKKWRQQFEWYATAIQLGKKPADIQAATFMSIIGPDAIDIYNSFNLNTIDEQKLSIIIGKFEEYFAPKNNISFERYVFFKIEQHEDESFNEFITRIKTQANKCEFGTLLEEMLKDKIVFGIKSTQIREKLLTEEKLDLTKATAICKSSEQASKQLNEFENNNKSEKILTIKSKNFRNEKFDCKRCGSNHKARECQAYNKLCTKCNKAGHFAKMCRSKIQLKQKNKINTLEENSTSENSDESFIGQLSVGNSKDWTESVETANTKFTAKLDTGAECNVLPNFIVQKTHACIQPSRTKNLISYSNNRISVLGEVKLQCKIKKKTAKILFKVVAERVTPVLGLNTCEKLGLIARVETLKESSSNDDIFKGLGCYKNFEYDIDLIENPKFEIKPTRKVPHAIRNEVKQELDRMVKLDVITPETEPTPAKEELQKTVKEVIETLKISGFKLNQSKCIFEAKRIKFLGHIVSAKGLEADPEKVKAIEFMKTPQNKKELQRILGMITYLNKYIPNMSELTNPLRDLLHKDTSFNWEFYHDEALNKIKKVLQNPPVLKLYDEEDLKISIILPTTFDYTEELIKATKEDPHLQLLLKTIMKGFPEKADQLPTELHHYFNFKEELTYFKGLIFKGYKIVVPKTQIPQMLKYIHQGHLGIQSCLKRAHQLLYWRGQYEDIVKLVRSCSACEKTQKDNTNYTVAVKRIPSLPWQIVASDLFELKGKQYIVICDSYSGYLDFQSLKSSSSTEVINHLKQWFSTHGIPEVLESDNGPQYMSREFKNFQKEWRFTHSTSSPHHPQGNGLAERAIQTAKNLLRKCSIDKSDIQLALLNWRNTPRTNNLGSPNQRLYSRITRSLIPTSENNLKPKIVQGVTSELKIRHKVGHRQWEGARVIEKPNDHPRSIIIKTDKGQIFRRNIGHIHNTLSDLSIGSKEAVPETVYPDDLPHAQSDKQPELPAAATTSQEQTTTSPRINCKSSASEAPVITSSDQPTTRCSRFGRTIKPVDRLDL

Summary

Uniprot
ProteinModelPortal
PDB
3JCA     E-value=1.37169e-14,     Score=198

Ontologies

Topology

Length:
1028
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00374
Exp number, first 60 AAs:
0.00173
Total prob of N-in:
0.00019
outside
1  -  1028
 
 

Population Genetic Test Statistics

Pi
198.191831
Theta
157.6768
Tajima's D
1.676462
CLR
0.083518
CSRT
0.823958802059897
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号