SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10397
Pre Gene Modal
BGIBMGA007034
Annotation
PREDICTED:_G_protein-activated_inward_rectifier_potassium_channel_3-like_isoform_X2_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 2.877
 

Sequence

CDS
ATGTCTGACAAGACCTCATCGTCGGTCGGTCCCCGAAGTTTCGAGACGATTTCGGAGGAGGACGTGACGTCACCCTGGGAGAAACTGTTGGATGATGTTAATACTGCCGTTCCTACTATAATTAAAACTAATGCGTCGAGTGCAACGATTTCAAGAATCGGGGAGGAGGTGTCTACGCACCCCCGAGTCGTGGACTTAGAGGCGAACAAGTTGACGCGCTCCAAGAGTCTCAACCAGCGGAGGAATAGCAGCGGCCTCCTCAGTTCTATCCCCCGGCAGCTGCGGCTCTCTCTCCGTGGCGTTCGCAGTGAACCCTCCAGCGTCAAGGACGTCCCGACAACTAGAAACGATAGTGCCCTCAATCTTCTTCTTAAATACCGTAATGCTCGTTACGCAGCGAGACGTGTGCGGAAGCGCGTCATCTTCAAGCACGGAGACTGCAACGTGGTCCAATGGAACGTGGCTAAGCGCAGGCGCCGATACCTTCAGGACATCTTCACGACCCTCGTGGACGCCCAGTGGCGCTGGACGCTGCTAGTGTTTGCGCTTTCCTTCATCCTCTCGTGGCTCTTGTTCGCACTTATCTGGTGGCTCATTATTTTCACTCACGGAGACCTCACCCCAATTCCACTTACGGAACAGAGAGAACCACCCGTTCCCTGCCTCAACAACGTCAACTCCTTTACTGGCTGCTTCCTCTTTTCTGTTGAAACTCAGCACACCATCGGCTATGGATCAAGGACAACGAATGAAGAATGCCCCGAAGCGATATTCGTCATGTGCATACAAAGTATTGTCGGAGTTTTCATTCAAGCTTTCATGGTTGGGATCGTGTTCGCGAAACTCTCTAGGCCAAAAAAACGCGCTCAAACTCTTCTGTACTCCAGGAACGCCGTAATTTGTTTAAGAGACGGGCAACTGTGTCTGATGTTCCGAGTCGGCGACATGAGAAAATCTCACATAGTCGAAGCTCATATCAGAGCGCAAATCATACGCCGCAAGATAACAAGGGAAGGGGAAGTTTTGCCCTTTTACCAGCAAGAGTTGAAGGTGGGAGCTGATGGCGAAGAAGACAGACTTATGTTTATTTGGCCTATGACCATAGTACACAAGATCAATGAGAAATCTCCGCTATACAATTTGTCAGCGTCGGATATGCTCAGAGAGAGATTCGAGATCGTAGTTATGCTTGAGGGTGTCATAGAGTCAACGGGAATGACAACTCAAGCCCGCAGCAGCTTCTTACCATCAGAAATTCTCTGGGGACATCGTTTCGAGACCATGGTCAAGTTCAGAAAGGATACCGGTGAATATGAGGTTGATTACACGCGGTTTAACAACACATACGAGGTGGACACGCCTTTGTGTTCAGCAAAACAACTAGACGAACTGCGCGCCTCTGTTTCAACTTCACAGAAACTCGATCGCATGCTACCGAAAACATTCTCAAACGACACCCTAGAGCTGAGCTCCATCGATTCGATGTCTTTGGATGAGCACATCGAGATTAAGATTCCGGAATCGAGGGCCCGCGAGAACAGACTGATGGCGCAAACAAACTTTGTACAACACGTCAACGAGAAAAACAAAAACCCAAGTCATCATAACCACTTGGCCGTTGAAAACGGACAAGATTTACTGCACAAGAACACTATAGAGAGTAGAGTCGAAGGAAAGGACAATCATCATATGCACAGAAGTCATAGTCATGCCAGCATGAAGAGGGTTCATGGGCTAATACCGAACGGGATATGCCATCCGATTAGTGGTCATGAACATGTACCCGACGATCATACTCTAAACAAATCCCCGAGTGAAAACTTCATAGGGAAAACTCCAGTGATTCCCATCCTTGTAACGTCACCGGAGGCGGAGCCCGCCTGA
Protein
MSDKTSSSVGPRSFETISEEDVTSPWEKLLDDVNTAVPTIIKTNASSATISRIGEEVSTHPRVVDLEANKLTRSKSLNQRRNSSGLLSSIPRQLRLSLRGVRSEPSSVKDVPTTRNDSALNLLLKYRNARYAARRVRKRVIFKHGDCNVVQWNVAKRRRRYLQDIFTTLVDAQWRWTLLVFALSFILSWLLFALIWWLIIFTHGDLTPIPLTEQREPPVPCLNNVNSFTGCFLFSVETQHTIGYGSRTTNEECPEAIFVMCIQSIVGVFIQAFMVGIVFAKLSRPKKRAQTLLYSRNAVICLRDGQLCLMFRVGDMRKSHIVEAHIRAQIIRRKITREGEVLPFYQQELKVGADGEEDRLMFIWPMTIVHKINEKSPLYNLSASDMLRERFEIVVMLEGVIESTGMTTQARSSFLPSEILWGHRFETMVKFRKDTGEYEVDYTRFNNTYEVDTPLCSAKQLDELRASVSTSQKLDRMLPKTFSNDTLELSSIDSMSLDEHIEIKIPESRARENRLMAQTNFVQHVNEKNKNPSHHNHLAVENGQDLLHKNTIESRVEGKDNHHMHRSHSHASMKRVHGLIPNGICHPISGHEHVPDDHTLNKSPSENFIGKTPVIPILVTSPEAEPA

Summary

Similarity
Belongs to the inward rectifier-type potassium channel (TC 1.A.2.1) family.
Pfam
PF17655   IRK_C        + More
PF01007   IRK
Interpro
IPR040445   Kir_TM        + More
IPR016449   K_chnl_inward-rec_Kir       
IPR014756   Ig_E-set       
IPR013518   K_chnl_inward-rec_Kir_cyto       
IPR041647   IRK_C       
SUPFAM
SSF81296   SSF81296       
Gene 3D
PDB
3SPI     E-value=1.36229e-91,     Score=860

Ontologies

Topology

Subcellular location
Membrane  
Length:
627
Number of predicted TMHs:
2
Exp number of AAs in TMHs:
47.29982
Exp number, first 60 AAs:
0.0016
Total prob of N-in:
0.85629
inside
1  -  177
TMhelix
178  -  200
outside
201  -  255
TMhelix
256  -  278
inside
279  -  627
 
 

Population Genetic Test Statistics

Pi
281.206716
Theta
194.749281
Tajima's D
0.629665
CLR
0.467515
CSRT
0.556922153892305
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号