SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10396
Pre Gene Modal
BGIBMGA007070
Annotation
PREDICTED:_G_protein-activated_inward_rectifier_potassium_channel_3-like_isoform_X3_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 3.422
 

Sequence

CDS
ATGAGAGTGTCTGTCAGTCGTGACCGAAATATTATCAGGCGCGATGCTTCAGGAGGCTTGAGATCATCGAGGGATGGTGGCGCAGACAGTACGCGATTGAGACGCGCGCACGACGCCTGCGCACCAGACTCCGCCATGCACGCCGATCCCGAGTCGCCCTGTTGTCGTGAGGAGACACAGCTGCTCCCCGACGAGTGGCTCAAAGTCAAGACGGTACCCACCAACGGGAACCTATCGCCCGGAGTCTACTATCCAACAGGCAGCAAGAGGAGCCGATCGCACCGGCATGGCGTCACTAGAAGGACTAGACGGAGAGCGATTCTCAAAAATGGAGAGTGCAATATTCTCAAGTCCCGAATCTCTCAGCGGCGTTTGAGATTCCTGCAAGACATGTTTACGACTTTAGTTGACGCACAATGGCGGTGGACCCTCCTTGTTTTCACACTATCGTTTATACTGTCGTGGTTGGGCTTTGCGTTGATCTGGTGGCTGATAGCATTCACACACGGCGACCTGGAACCGGACCACCTACCGCCATTACAGGACTCTGCGAATTGGAAGCCGTGCGTTTTTAACATAAACGATTTCACGTCGTGTTTCTTGTTCAGTATCGAAACGCAGCACACCATTGGCTACGGTGCCCGTACTACAACGGAAGAATGTCCGGAGGCCATTTTCATAATGTGCCTCCAAAGTATCGTCGGTGTGATGATTCAGGCGTTCATGGTCGGTATCGTGTTCGCAAAGATGACAAGACCTAAGCATAGAACGCAGACGTTACTGTTCTCGAAGTATGCAGTCGTGTGTCAAAGAGATGGCGAGTTAAGTTTAATGTTCCGAGTGGGCGACTTGAGGAAATCGCACATAATAGGGGCGAGCGTGAGAGCGCAGTTGATTCGATCGCGGACGACTAAGGAAGGAGAGGTATTGTCGCATTATCAAACCGAATTAGAACTCAACGCAGATGGATGTGACAGCAATCTTTTCTTCATCTGGCCTATTACGATGGTACATAGAATAAATCGCGACAGCCCCTTCTACGGAGTGTCAGCGGCGGACGTACTACAAGAAAGATTCGAAATAGTAGTTATATTGGAAGGAACAATTGAATCGACGGGTCAAACCACACAGGCGCGCTCCAGTTACACAACCAGTGAAATTATGTGGGGGCATAGGTTCGTTCCGCTTGTGACGTACAACCGTGAACGACAAGGATATCAAGTGGATTATTCTAAATTTGACGAGACGACCCAGGTGGACACTCCGCTCTGTTCAGCAAAAGAGCTAGACGAATTTTACGGCAGCCAGGCTGATCGTAGATCTATCGAAAGCGCGGAACATCCACAGCAGCAGTTAATTCTGAAGATGCCGGATAGAGCTCCTACCACCGAACCTAAGGCCGAAAATAAAGACGGCGACTTCACTGTTACGTTGTAA
Protein
MRVSVSRDRNIIRRDASGGLRSSRDGGADSTRLRRAHDACAPDSAMHADPESPCCREETQLLPDEWLKVKTVPTNGNLSPGVYYPTGSKRSRSHRHGVTRRTRRRAILKNGECNILKSRISQRRLRFLQDMFTTLVDAQWRWTLLVFTLSFILSWLGFALIWWLIAFTHGDLEPDHLPPLQDSANWKPCVFNINDFTSCFLFSIETQHTIGYGARTTTEECPEAIFIMCLQSIVGVMIQAFMVGIVFAKMTRPKHRTQTLLFSKYAVVCQRDGELSLMFRVGDLRKSHIIGASVRAQLIRSRTTKEGEVLSHYQTELELNADGCDSNLFFIWPITMVHRINRDSPFYGVSAADVLQERFEIVVILEGTIESTGQTTQARSSYTTSEIMWGHRFVPLVTYNRERQGYQVDYSKFDETTQVDTPLCSAKELDEFYGSQADRRSIESAEHPQQQLILKMPDRAPTTEPKAENKDGDFTVTL

Summary

Similarity
Belongs to the inward rectifier-type potassium channel (TC 1.A.2.1) family.
EMBL
KQ459603    KPI93008.1    BABH01014775    AGBW02008324    OWR53664.1    ODYU01001885    + More
SOQ38719.1    JTDY01000713    KOB76123.1    KQ460685    KPJ12786.1    GDQN01008428    JAT82626.1    RSAL01000218    RVE44089.1    GFDL01005823    JAV29222.1    DS232728    EDS45184.1    GFDL01005841    JAV29204.1    KF686746    CH477543    AIN76714.1    EAT39258.1    GFDL01003615    JAV31430.1    GFDL01003851    JAV31194.1    KF686745    AIN76713.1    EAT39257.1    KF686744    AIN76712.1    EAT39256.1    GAPW01001525    JAC12073.1    GFDL01000192    JAV34853.1    GANO01003364    JAB56507.1    GFDL01000195    JAV34850.1    KQ414608    KOC69364.1    CVRI01000047    CRK98501.1    CRK98502.1    GALX01002281    JAB66185.1    APGK01057039    KB741277    ENN71258.1    GL448287    EFN84913.1    KQ435791    KOX74402.1    BT127111    KB630626    KB631617    KB631850    AEE62073.1    ERL83730.1    ERL84721.1    ERL86721.1    GEZM01004174    JAV96445.1    GEZM01004173    JAV96446.1    QOIP01000009    RLU18987.1    GL763289    EFZ19901.1    ADTU01002433    ADTU01002434    ADTU01002435    ADTU01002436    ADTU01002437    AXCN02001514    GL437384    EFN70512.1    KQ981200    KYN45082.1    JR035661    JR035662    JR035663    JR035664    JR035665    JR035666    JR035667    JR035668    JR035669    JR035670    JR035671    JR035672    AEY56573.1    AEY56574.1    AEY56575.1    AEY56576.1    AEY56577.1    AEY56578.1    AEY56579.1    AEY56580.1    AEY56581.1    AEY56582.1    AEY56583.1    AEY56584.1    KK107320    EZA52801.1    KQ982617    KYQ53796.1    KQ981113    KYN09394.1    KQ978350    KYM94689.1    GBYB01000163    JAG69930.1    NEVH01019065    PNF23184.1    KQ767621    OAD53388.1    AAAB01008987    EDO63275.2    KK853134    KDR10854.1    APCN01000829    EAA43222.5    PNF23185.1    GBYB01003841    JAG73608.1    GGFK01006647    MBW39968.1    GGFL01002636    MBW66814.1    ADMH02002066    ETN59720.1    LJIG01022677    KRT79300.1    AXCM01007933    GFDF01009053    JAV05031.1    GGFJ01005329    MBW54470.1    GGFL01002581    MBW66759.1    ATLV01019123    KE525262    KFB43773.1    NNAY01002130    OXU21996.1    GGFM01007085    MBW27836.1    GGFJ01005331    MBW54472.1    GAMD01000792    JAB00799.1    GGFJ01005330    MBW54471.1    GGFJ01006368    MBW55509.1    GGFM01002458    MBW23209.1    EGK97615.1    GDHF01001363    JAI50951.1    KFB43774.1    GBXI01007785    JAD06507.1    GDHF01019449    JAI32865.1    GDHF01021228    JAI31086.1    EAA01723.5    GBXI01001394    JAD12898.1    GAMC01019801    JAB86754.1   
Pfam
PF17655   IRK_C        + More
PF01007   IRK
Interpro
IPR014756   Ig_E-set        + More
IPR041647   IRK_C       
IPR016449   K_chnl_inward-rec_Kir       
IPR013518   K_chnl_inward-rec_Kir_cyto       
IPR040445   Kir_TM       
SUPFAM
SSF81296   SSF81296       
Gene 3D
PDB
3SPI     E-value=2.15543e-99,     Score=926

Ontologies

Topology

Subcellular location
Membrane  
Length:
478
Number of predicted TMHs:
2
Exp number of AAs in TMHs:
46.1505000000003
Exp number, first 60 AAs:
0
Total prob of N-in:
0.99733
inside
1  -  143
TMhelix
144  -  166
outside
167  -  223
TMhelix
224  -  246
inside
247  -  478
 
 

Population Genetic Test Statistics

Pi
262.448885
Theta
219.045867
Tajima's D
0.807667
CLR
0.002938
CSRT
0.603169841507925
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号