SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10379
Annotation
hypothetical_protein_M514_07281_[Trichuris_suis]
Location in the cell
Nuclear   Reliability : 3.793
 

Sequence

CDS
ATGGATAAATACAATCCAGATACATTCAGAATTGACGATTACATTGATTTTTTCGAAAACAAATGCAAAATTCTTGATATCGATAACAGCGACTTACAGAAAGATTTGCTTCTGAATTTACTAACACCAGAGATATTCCACGAATTAAAAGTAGCTTTAACGCCTGATTTCGATATAGCTACATACAGCGAAATTTGTAACAAATTATTAGACCTCTATCGCATAAAAACGACGAGTAATAACAAAGAAGAAAGCGATGATGAAGTTATCTGCAGCGTCTTGGGTACACGTAAGAGAGAATGCAAACAAATCGATGTACGCATCAATGACATACCTTGCACTATGGATTGGGACCCCGGCTCTGCGTATTCAATAATAAACACGACATTATGGAAAAAATTAGGATCACCATCTTTACAACCCGCCCCGAAACTTAAGGCCTACGGTAACACAAACTTAAAAACAAAGGGAATTACAAAAGTAACAGTCGAAGTCGACGGACTGCAAAAACTTCTACCTGTGGTCGTAATGAAAAATGCCAAACCAATGTTATTTGGTTTACATTGGAGTGAAGTTTTTGAAATGGAATTTCCAAAACCAGTATACTCCATCAAAACATCAACACCGATGACTCTTAAACAAATATTGGATAAACATGTACAACTCTTTGATGGAAAACTAGGAAAAGTTAACAATTATTACGTAAACATACATGTCAAACCAGAAGCTGAACCGATCCACCTTCCTGCACGGCCTATAAAATTCAGCATGAAAAAGAATATAGAAAGGGAGTTAGATCGTCTGATCTCAGAAGGGATAGTGGAAAAAGTAGATCCTAATATTACACCTATTGAATGGGCTACACCCACAGTTAACATTCTGAAATCTACAGGGGAAATTAGGATATGTGGAGACTACAGAACTACACTTAATCCAGTACTTATTAAACATCTACACCCAGTTCCGGTTTTCGATCAACTACGCCAAAATCTCGCAAACGATACAAAGAAATGCATAACGTCTTCACAACCATTAATTGCATTTGACGAGAAACGTCCCCTTTATTTAGCATGTGACGCTTCCGAAAAGGGATTGGGTGCAGTATTATTCCACAAGGACTCGAACATAGAACAGCCAATTGCTTTTGCTTCAAGGAAACTACGACCAGCGGAAATGAAATATTCCGTTATTGATCGGGAAGCTTTAGCAATAGTATTTGGTATAAAAAAATTTGATCAGTATTTGAGAGGAACGAAATTTAATCTAGTTACGGACCATAAGCCTCTTATACATATTATGGGTGCACGCCGCAACCTTCCTAAACTAGCCAATAACCGATTGGTAAGATGGGCCCTAGTAGTGGGAAGTTATCAATATGACATTTACTACAGGAAAGGTGAAAATAACACATTAGCTGATTGCCTTTCCAGATTACCAAACCCTGAAACTGAACCCTCCGAGACAGAAGGGCTTGTACATAAAATAGATCTACGTCTTTTGAGCACTCGAATGACTGACCTTAACCTATCAGAACAGTTACTTATGAAAACAACTGCAAAGGATCATATACTCACAAAAGTTTGTCATAATTTAAAAACCGGCTGGAGAGAATCAGAATACAATCCAGAAATGAAACCATTCTACAGAAACCGGACTGAATTATCTGTTGAGAATAAGATACTTATGAGGCAAGGACGCATCGTTATACCTACAGCACTCCGAAAAGCCATTCTTACATACCTTCATCGAGGACACCCTGGCATTTCTGCTATGAAAGCACTTTCACGTTACTATGTTTGGTGGCCTAACCTTGACGAAGACATAGAATTATTTGTCAAGAAATGTACCAGATGCCAACAGAACCGCCCTTGTAATCCTGAACTTCCTGTATTTTCCTGGTCCATACCAGAAGAAGTATGGGAGAGAATCCATATCGACTTTGCTGGACCGTTCGAAGGATCGTATTGGTTGGTATTGTGCGACGCTCTCTCCAAATGGGTGGAAATACGACCGATGAAACACATCAACACCAGATCACTTTGTCTTACATTAGATAACATATTTTGTACATTTGGCTTACCAAAAATGATTATATCCGATAATGGACCTCAATTTACATCTTATGAATTTAAAGAATATTGCACAAAACAGTCTATTTTACATGTCACATCATCTCCATATCATCCTCGGACAAATGGGCTGGCAGAACGTTTAGTCAGAACATTCAAAAATAGAATGGCATCGGTAGACAACACAAATCTCGAGCGCCGACTATTAGAATTTCTGTTTACATACAGAAACACTCCGCACTCGTCCACTGGTAAATCTCCAGCTGAGATGATGTTTGGAAGACAATTGAATTGCATACTTTCCAACATTCGGCCAGACAAAAGAAGGTTAATGCAGTATTTACAAGTAAAAGAAAATATTCGTACCAGATCACCGAGTTACCGACCAAGTGACCAAGTATATATTAAAACACGCAATGATAAAATATGGGAACCAGCGGTAATTACATCCCGAAAACATAAATATTCATATATTGTTTCAACACCAGGAGGACTAGAAAAACGAAGACACGCTGATCACATCAGGCCACGCGAGTCTTCCACCTCAGAAACCCCGAGGAATGAAAGGGCGCATTCTTCTATGCTGCCGACGACTGCTTCTCCAGACATTGGAATGGAAACATCAATTAGCGAAAGGCTAACTAACAATAAGAATTCGGCAGCAGTACCATTACCTACACCGCAGTCGCCTACAAATGTACAAATTTCTCCAAATTCACCTTCACAGCATTCGAAGTTATACTCCTCACCTGCTCCGGTCTCCACTCCTGTGCCATTTGCTCCGCGTCGAAGTAATCGACCTAAACAGGCACCCCGCCGTCTGATCAACGAGATGTAG
Protein
MDKYNPDTFRIDDYIDFFENKCKILDIDNSDLQKDLLLNLLTPEIFHELKVALTPDFDIATYSEICNKLLDLYRIKTTSNNKEESDDEVICSVLGTRKRECKQIDVRINDIPCTMDWDPGSAYSIINTTLWKKLGSPSLQPAPKLKAYGNTNLKTKGITKVTVEVDGLQKLLPVVVMKNAKPMLFGLHWSEVFEMEFPKPVYSIKTSTPMTLKQILDKHVQLFDGKLGKVNNYYVNIHVKPEAEPIHLPARPIKFSMKKNIERELDRLISEGIVEKVDPNITPIEWATPTVNILKSTGEIRICGDYRTTLNPVLIKHLHPVPVFDQLRQNLANDTKKCITSSQPLIAFDEKRPLYLACDASEKGLGAVLFHKDSNIEQPIAFASRKLRPAEMKYSVIDREALAIVFGIKKFDQYLRGTKFNLVTDHKPLIHIMGARRNLPKLANNRLVRWALVVGSYQYDIYYRKGENNTLADCLSRLPNPETEPSETEGLVHKIDLRLLSTRMTDLNLSEQLLMKTTAKDHILTKVCHNLKTGWRESEYNPEMKPFYRNRTELSVENKILMRQGRIVIPTALRKAILTYLHRGHPGISAMKALSRYYVWWPNLDEDIELFVKKCTRCQQNRPCNPELPVFSWSIPEEVWERIHIDFAGPFEGSYWLVLCDALSKWVEIRPMKHINTRSLCLTLDNIFCTFGLPKMIISDNGPQFTSYEFKEYCTKQSILHVTSSPYHPRTNGLAERLVRTFKNRMASVDNTNLERRLLEFLFTYRNTPHSSTGKSPAEMMFGRQLNCILSNIRPDKRRLMQYLQVKENIRTRSPSYRPSDQVYIKTRNDKIWEPAVITSRKHKYSYIVSTPGGLEKRRHADHIRPRESSTSETPRNERAHSSMLPTTASPDIGMETSISERLTNNKNSAAVPLPTPQSPTNVQISPNSPSQHSKLYSSPAPVSTPVPFAPRRSNRPKQAPRRLINEM

Summary

Pfam
PF00665   rve        + More
PF17919   RT_RNaseH_2
PF17921   Integrase_H2C2
PF00078   RVT_1
Interpro
IPR001584   Integrase_cat-core        + More
IPR041577   RT_RNaseH_2       
IPR021109   Peptidase_aspartic_dom_sf       
IPR034128   K02A2.6-like       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR000477   RT_dom       
IPR012337   RNaseH-like_sf       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
Gene 3D
PDB
3S3O     E-value=1.03942e-16,     Score=216

Ontologies

Topology

Length:
968
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00173
Exp number, first 60 AAs:
0.00017
Total prob of N-in:
0.00010
outside
1  -  968
 
 

Population Genetic Test Statistics

Pi
472.547248
Theta
216.807291
Tajima's D
3.822689
CLR
0.047826
CSRT
0.998050097495125
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号