SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10358  Validated by peptides from experiments
Annotation
PREDICTED:_uncharacterized_protein_LOC106142516_isoform_X2_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 1.561 PlasmaMembrane   Reliability : 1.412
 

Sequence

CDS
ATGGATGAACACACCTCAACGGACACAGTGCAAGAAAGCTCAAATCCAACATTACATGTTGAAGCACCAACAGATTGTGACTTTAACTTAACCCCTGTACAAATACAACAGCAATATTTTGAAAACTTAGGGGATTGTAACTGGATTAGATATGAAAAGTGCAATAGAAATCATTTATTGCAAAACTTGGCATTTGGACTATTTGGTCCTCCGATTACTGAAGGGGAGCTGATAGAAAAGGAAGAAATGAATGCAATTAATCTTCAAGGATACACTTCCAGACAAAAAGAAAAAGTTGACTTAGTCTATGCAAAAATATGTGAACAAGGTAAATATTCATTTGAAGATGAAATTTATATGTCGAATTTACTGGTTGTTTGTGCACGTCCAAAGCCCAAGAATTTTTTAAACATTCAACCGTCGAAATGTTGGATTGATCTACACGAACGGAGTGACTCCGAAATATGGCTCGTACCTGTATTTTGCATAAGAAAATGTATACCTATAGAAATGAATGCGAAACCATGCAAAATATATATTGATGACAATGCCCGGGTGTACCATAGTTGGAATGCTTACTTGACAGAAAACACATTGGACAAATGTGTTCTAATAGTCCCTGAGAACGGAGAATATACCGGAACACTTACTGAGGACGGAACAGACTTCACGGTGAATCTAACAGTGGCGCCGTCACCTGCCCTCGGACTGAAGTCACGCGTGCTGAGTACGGTGGACACAGCGACCACGGTGGTCTCGCTGAGCGCCGTGGGAGTGGTCGGGGTGGCCGCGCTAACACCGGTGGCGCCCGTGCTGCTCGCAAGCGCGGCCACCGTCTCCGTCACCGCGGGAATCTACGGGCTGATCAGGTCTTCGTTGCATTTACACGACCGAAGGACGCACGAACAGACCATAAACGTGACCAATTCTGAAGCTCGTAACAGTTGGTTAAACATAGCGGCCTCGGGCGTGGGTCTCACGGCCGGAGCGGCCAGCAATCTCCTGTCTAAATCAGCAGCGGCCGGCACCAACCTCACTACGTCGGGGAGGTTCTTGACGAAGTCAGTCGACGTGCTGCGACACGCGAACCCGTTGACCGGAGCTGCGAGCTTTACTAATGGCTTTGTGTATCTTATAATACAGTACAGGAAACACGGTCAGAAGCCGAGTCGTATTGAGATATTCCAATTCGCCATGTCGACGTTGTTCTTCTTCAACGCTGTCGTATCGAATCAGACGGCGCAAGAGATCATTGAGCAGAGTCAGGCGAACAAGATAAATGAGTTCCGCGATACGCTCCGGAGTAATCGGCACAGGAAAATTTTCGATAAGCTTTCCGCCGAAGCTAGACGAGTGCGGGGCACCGTTCAAGGTAACACCGAAGTCATCCAGGGCATCAAGAATATCGCTAACAAAGACGAATACTTTGCGCAAGTTCTGAGCATCAACAAGGACGTGAACCAGCACAGGCTCAGGATATCGATGACAGCCGACGGCCGGGTCATGTTGAACAACCAACACGGGTACAACCCGTCCGAGTTACACTCGCTCGGCTCGGAAGGGAGATCGCAAATATTCACCGAAATCGGCCCAGCCCCCCCGGGGCCTGCTAATGTGTCCACACGTCTGAACTCGCCCGTCAACAGAGTGGACAACTACTTCGGAGTAGACGACGAAGAAGGCCATTTATTAGTCGGCATCCGTCCAGAAGAGATACTCCAAATCGGCACATATTTCGTGCGTATCAGCTCGTCGGGCACCGATGAAATAGTTTCGATGCTCCAAAATCTCTCCGAAGAGGTCTATACGAATTTGATGACCCTATCCTTTAATCTGCTGTCGAAACTTGTGCCAAGCGAAATTGCCAATCTGAAGTTGCTCAGTCCGGAGCGAGATTTGATTTCGCAGGTAGTTGAATTCGTTTTCAATTACATGAAACAGCGGAGACCGTTCGGGGAAGCGAGACATGACGATAACGGAATCGTTGAAGTAGTAAAAGACTTCTTTCACGATGGCCGAGTTAATCAAGACACGATATTGCGATTGAAGAAAGATTTAATCGAATGGCTGGACGATGAAATTACACGTAAAAATGAGCTAAATCCTAATAAGAAATCCTTAATCTGCAATGTGTGTAAAGGAGTTAGATACGCTTAA
Protein
MDEHTSTDTVQESSNPTLHVEAPTDCDFNLTPVQIQQQYFENLGDCNWIRYEKCNRNHLLQNLAFGLFGPPITEGELIEKEEMNAINLQGYTSRQKEKVDLVYAKICEQGKYSFEDEIYMSNLLVVCARPKPKNFLNIQPSKCWIDLHERSDSEIWLVPVFCIRKCIPIEMNAKPCKIYIDDNARVYHSWNAYLTENTLDKCVLIVPENGEYTGTLTEDGTDFTVNLTVAPSPALGLKSRVLSTVDTATTVVSLSAVGVVGVAALTPVAPVLLASAATVSVTAGIYGLIRSSLHLHDRRTHEQTINVTNSEARNSWLNIAASGVGLTAGAASNLLSKSAAAGTNLTTSGRFLTKSVDVLRHANPLTGAASFTNGFVYLIIQYRKHGQKPSRIEIFQFAMSTLFFFNAVVSNQTAQEIIEQSQANKINEFRDTLRSNRHRKIFDKLSAEARRVRGTVQGNTEVIQGIKNIANKDEYFAQVLSINKDVNQHRLRISMTADGRVMLNNQHGYNPSELHSLGSEGRSQIFTEIGPAPPGPANVSTRLNSPVNRVDNYFGVDDEEGHLLVGIRPEEILQIGTYFVRISSSGTDEIVSMLQNLSEEVYTNLMTLSFNLLSKLVPSEIANLKLLSPERDLISQVVEFVFNYMKQRRPFGEARHDDNGIVEVVKDFFHDGRVNQDTILRLKKDLIEWLDDEITRKNELNPNKKSLICNVCKGVRYA

Summary

Pfam
PF16013   DUF4781        + More
PF00567   TUDOR
PF00006   ATP-synt_ab
PF02874   ATP-synt_ab_N
PF16886   ATP-synt_ab_Xtn
Interpro
IPR031962   DUF4781        + More
IPR035437   SNase_OB-fold_sf       
IPR002999   Tudor       
IPR029071   Ubiquitin-like_domsf       
IPR006577   UAS       
IPR027417   P-loop_NTPase       
IPR020003   ATPase_a/bsu_AS       
IPR022878   V-ATPase_asu       
IPR000194   ATPase_F1/V1/A1_a/bsu_nucl-bd       
IPR024034   ATPase_F1/V1_b/a_C       
IPR036121   ATPase_F1/V1/A1_a/bsu_N_sf       
IPR023366   ATP_synth_asu-like_sf       
IPR031686   ATP-synth_a_Xtn       
IPR005725   ATPase_V1-cplx_asu       
IPR004100   ATPase_F1/V1/A1_a/bsu_N       
SUPFAM
SSF54236   SSF54236        + More
SSF52540   SSF52540       
SSF50615   SSF50615       
Gene 3D

Ontologies

Topology

Length:
718
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
49.28567
Exp number, first 60 AAs:
0.00172
Total prob of N-in:
0.56534
outside
1  -  718
 
 

Population Genetic Test Statistics

Pi
40.915077
Theta
152.825306
Tajima's D
-0.955261
CLR
0.584111
CSRT
0.145642717864107
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28556443 NFLNIQPSK 100.00 3e-05
28556443 THEQTINVTNSEAR 100.00 3e-05
28556443 GLFGPPITEGELIEK 100.00 1e-04
28556443 EEMNAINLQGYTSR 100.00 1e-04
27102218 NFINIQPSK 100.00 0.002
28556443 YHGESHFKPPTMDELPVPK 100.00 0.006
26822097 IEEEKDSIISTIDSIK 100.00 0.020
25044914 THDVVQQFAGFK 100.00 0.020
27102218 MNAINIQGYNSR 100.00 0.020
28467696 THDFGYVSMTISHVRDEDEGVYMCR 100.00 0.020
28556443 SAAAGTNLTTSGR 100.00 0.020
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号