SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10356  Validated by peptides from experiments
Annotation
PREDICTED:_uncharacterized_protein_LOC106142516_isoform_X1_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 2.357
 

Sequence

CDS
ATGGAATTGACTCGAGAAAATTCAAGAGCGATGATTTATTATGACTTTCGAAGTGGTTTAACACAAAAACAGTGTGTTGACCGGATGATTTCTGCATTTGGTGATGAAGCCCCATCCAAAACCACAATTTATCGCTGGTTTGCTGAGTTTCAACGTGGACGTGTCAAGCTTAGTGATGATCCCCGTCAAGGACGTCTAAAAACTGCAGCCACCCAAGAAAACGTTGATGCTGTGCGTAAGCTGATTGAGGAAGATCGACATGTGACATACCGCGAAATTCAGGCAGCTTTAGACATTGGCATGAGTCAAATACAAATAATTTTGCAGGAACAATTAGGTGTAAAAAAGTTGTTTTCCCGATGGATACCGCATTCGCTCTGTGAAGAGCAAAAAGCGGCTCGCGTTACTTGTACAATGGATGAACACACCTCAACGGACACAGTGCAAGAAAGCTCAAATCCAACATTACATGTTGAAGCACCAACAGATTGTGACTTTAACTTAACCCCTGTACAAATACAACAGCAATATTTTGAAAACTTAGGGGATTGTAACTGGATTAGATATGAAAAGTGCAATAGAAATCATTTATTGCAAAACTTGGCATTTGGACTATTTGGTCCTCCGATTACTGAAGGGGAGCTGATAGAAACGGAAAAAATGAATGCAATTAATCTTCAAGGATACAATTCCAGACAAAAAGAAAAAGTTGACTTAGTCTATGCAAAAATATGTGAACAAGGTAAATATTCATTTGAAGATGAAATTTACATGTCGAATTTACTGGTTGTTTGTGCACGTCCAAAGCCCAAGAATTTTTTAAACATTCAACCGTCGAAATGTTGGATTGATCTACACGAACGGAGTGACTCCGAAATATGGCTCGTACCTGTCTTTTGCATAAGAAAATGTATACCTATAGAAATGAATGCGAAACCATGCAAAATATATATTGATGACAATGCCCGGGTGTACCATAGTTGGAATGCTTACTTGACAGAAAACACATTGGACAAATGTGTTCTAATAGTCCCTGAGAACGGAGAATATACCGGAACACTTACTGAGGACGGAACAGACTTCACGGTGAATCTAACAGTGGCGCCGTCACCTGCCCTCGGACTGAAGTCACGCGTGTTGAGTTCGGTGGACACAGCGACCACGGTGGTCTCGCTGGGCGCCGTGGGAGTGGTCGGGGTGGCCGCGCTAACACCGGTGGCGCCCGTGCTGCTCGCAAGCGCGGCCACCGTCTCCGTCACCGCGGGAATCTACGGGCTGATCAGGTCTTCGTTGCATTTACACGACCGAAGAACGCACGAACAGACCATAAACGTGCGCAATTCTGAAGCTCGTAACAGTTGGTTAAACGTAGCGACCTCGGGCGTGGGTCTCACGGCTGGAGCGGCCAGCAATCTCCTGTCTAAATCAGCAGCGGCCGGCACCAACCTCACTACGTCGGGGAGGTTCTTGACTAAGTCAGTCGACGTGCTGCGACACGTGAACCTTTTGACCGGAGCTGCGAGCTTTACTAATGGCTTTGTGTATCTTATAATACAGTACAGGAAACACGGTCAGAAGCCGAGTCGTATTGAGATATTCCAATTCGCCATGTCGACGTTGTTCTTCTTCAACGCTGTCGTATCGAATCAGACGGCGCAAGAGATCATTGAGCAGAGTCAGGCGAACAAGATAAATGAGTTCCGCGATACGCTCCGGAGTAATCGGCACAGGAAAATTTTCGATAAGCTTTCCGCCGAAGCTAGACGAGTGCGGGGCACCGTTCAAGGTAACACCGAAGTCATCCAGGGCATCAAGAATATCGCTAACAAAGACGAATACTTTGCGCAAGTTCTGAGCATCAACAAGGACGTGAACCAGCACAGGCTCAGGATATCGATGACGGCCGACGGCCGGGTCATGTTGAACAACCAACACGGTTACAACCCGTCCGAGTTACACTCGCTCGGCTCGGAAGGGAGATCGCAAATATTCACCGAAATCGGCCCAGCCCCCCCGGGGCCTGCTAATGTGTCCACACGTCTGAACTCGCCCGTCAACAGAGTGGACAACTACTTCGGAGTAGACGACGAAGAAGGCCATCTATTAGTCGGCATCCGTCCAGAAGAGATACTCCAAATCGGCACATATTTCGTGCGTATCAGCTCGTCGGGCACCGATGAAATAGTTTCGATGCTCCAAAATCTCTCCGAAGAGGTCTATACGAATTTGATGACCCTATCCTTTAATCTGCTGTCGAAACTTGTGCCAAGCGAAATTGCCAATCTGAAATTGCTCGATCCGGAGCGAGATTTGATTTCGCAGGTAGTTGAATTTGTTTTCAATTACATGAAACAGCGGAGACCGTTCGGGGAAGCGAGACACGACGATAACGGAATCGTTGAAGTAGTAAAAGACTTCTTTCACGATGGCCGAGTTAATCAAGACACGATATTGCGATTGAAGAAAGATTTAATCGAATGGCTGGACGCTGAAATTACACGTAAAAATGAGCTAAATCCTAATAAGAAATCCTTAATCTGCAATCTGTGTAAAGGAGTTAGATACGCTTAA
Protein
MELTRENSRAMIYYDFRSGLTQKQCVDRMISAFGDEAPSKTTIYRWFAEFQRGRVKLSDDPRQGRLKTAATQENVDAVRKLIEEDRHVTYREIQAALDIGMSQIQIILQEQLGVKKLFSRWIPHSLCEEQKAARVTCTMDEHTSTDTVQESSNPTLHVEAPTDCDFNLTPVQIQQQYFENLGDCNWIRYEKCNRNHLLQNLAFGLFGPPITEGELIETEKMNAINLQGYNSRQKEKVDLVYAKICEQGKYSFEDEIYMSNLLVVCARPKPKNFLNIQPSKCWIDLHERSDSEIWLVPVFCIRKCIPIEMNAKPCKIYIDDNARVYHSWNAYLTENTLDKCVLIVPENGEYTGTLTEDGTDFTVNLTVAPSPALGLKSRVLSSVDTATTVVSLGAVGVVGVAALTPVAPVLLASAATVSVTAGIYGLIRSSLHLHDRRTHEQTINVRNSEARNSWLNVATSGVGLTAGAASNLLSKSAAAGTNLTTSGRFLTKSVDVLRHVNLLTGAASFTNGFVYLIIQYRKHGQKPSRIEIFQFAMSTLFFFNAVVSNQTAQEIIEQSQANKINEFRDTLRSNRHRKIFDKLSAEARRVRGTVQGNTEVIQGIKNIANKDEYFAQVLSINKDVNQHRLRISMTADGRVMLNNQHGYNPSELHSLGSEGRSQIFTEIGPAPPGPANVSTRLNSPVNRVDNYFGVDDEEGHLLVGIRPEEILQIGTYFVRISSSGTDEIVSMLQNLSEEVYTNLMTLSFNLLSKLVPSEIANLKLLDPERDLISQVVEFVFNYMKQRRPFGEARHDDNGIVEVVKDFFHDGRVNQDTILRLKKDLIEWLDAEITRKNELNPNKKSLICNLCKGVRYA

Summary

Pfam
PF16013   DUF4781        + More
PF00567   TUDOR
Interpro
IPR031962   DUF4781        + More
IPR035437   SNase_OB-fold_sf       
IPR002999   Tudor       
Gene 3D
PDB
4U7B     E-value=1.00059e-07,     Score=138

Ontologies

Topology

Length:
856
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
66.4274600000001
Exp number, first 60 AAs:
0.00019
Total prob of N-in:
0.39679
outside
1  -  856
 
 

Population Genetic Test Statistics

Pi
191.897272
Theta
163.846103
Tajima's D
0.253994
CLR
1.496439
CSRT
0.448577571121444
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28556443 AYLTENTLDK 100.00 7e-06
28556443 YWSHEPAVVVSPTTGFVHVR 100.00 7e-06
28556443 NFLNIQPSK 100.00 3e-05
28556443 THEQTINVTNSEAR 100.00 3e-05
28556443 GLFGPPITEGELIEK 100.00 8e-04
28556443 EEMNAINLQGYTSR 100.00 8e-04
27102218 NFINIQPSK 100.00 0.003
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号