SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10353
Pre Gene Modal
BGIBMGA009311
Annotation
PREDICTED:_uncharacterized_protein_LOC105841282_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.799
 

Sequence

CDS
ATGGATTCGTTAAAACCACCGCCACCATTATGCCTCATGGGCGACTTGAAACAAAATTTTCAAAAATGGACACAGCAATATGATATTTATATGATTGCTAGCGGGACGGAAGGTGATGAAAAAATTAAAGATAAGCAGAAAAAGGCAATCTATTTGCACTGCCTAGGTGCAGAAGCACTAACCATATACAATGGTTTTAAGAACAAAGAAAAGTTATCTTATGTGGAAGTAAAACAGAAGTTTAATGAATATTGTTCGCCACCCGGAAATGAAACTTTTAGTAGACATGTCTTCTTCAGCAGAAAAAAGAGAGATGGAGAAAGTTTTGATGAATTTTTCTGTACGTTGAGAAAATTGGCGGGAGACTGTGGGTTTGCAGACCTAGAAGAAAGCTTAATAAGAGACCAAATCATATTAGGCTTAAATGATGCCAAATTAACAGAAAGATTGCTTAAGGAATCGACCTTAACATTGGATAGCTGCATGAAAATATGTAAAGTGGCTGAGAGTGCTGCAAAACAGGTTCAAGTCATGACAGAAAAGACAGTTGAAGCTGTTACAAGAAAACAAGAATCTCGAAGCAGAATGCCTAATCAGAATAAAACCAGTTTTAATAATAAACAACATCTAGGTAAGAGTGCAGAAGGATCAGTAAGGCTGAAGAATAATAATTGTGAAAGATGCGGAGGAGTGCATTCTCATCGATCCTGCCCAGCCTTTGGAAGGAGATGTGCTAAGTGTAATCGATATGGACATTACATGCAGATGTGCAGAACAGTTGGTGCTGTGTATGTCAGCGATGATGATAGTGATGACTCATTAGTAGTGGGGTCAGTAACTGTGGGCCAGGTTGATACAGAGGACTGGATCGTTGAGGCAAAAGTGAGAGGACAGAAGATGAAGTTCAAAGTGGATACAGGATCGCAGGTTAATATTTTGACTAGTGCTATAGTGAAAAAACTAGACTTAAAAATGACAGAAACTTGTACAAAATTAAAAAACTTTGATGGCTCAACTATAGAAACAGTAGGTATGACTAAAACTATAGTGAAATTCAATAAAAAAAAGTATGTACTTGACTTTTATGTGGTAAAATTTAAAACTACTAATGTGCTGAGCTATAAAGCTGCTGTGCAGTTGGGTTTAATAAACAAAGTTGAAAATATTTCAAAGGAATATGTAGTTCAGGACATTGGTGAATACAAAGATTTGTTTCATGGCTTAGGAAAATTGAACTATGTATACAAAATTAAATTAACAGACAATTGTGCACCTGTAGTGGAGCCACCAAGGAAAATTCCTTTTAAATTAGTAGATAAAGTAAAAAATGAGCTTGATCGATTGGAGCAACTTGATGTAATAAAGAAAGTGCAAGAACCAACTGAGTGGGTTAACTCTATGGCTTATTTGAGTAAAGAAAGGGAGATGTCATGTGAGGATACTTATTGGAATAAGCTGTGGTTGACATGTACGGGAGACGGCACTACAGAATAA
Protein
MDSLKPPPPLCLMGDLKQNFQKWTQQYDIYMIASGTEGDEKIKDKQKKAIYLHCLGAEALTIYNGFKNKEKLSYVEVKQKFNEYCSPPGNETFSRHVFFSRKKRDGESFDEFFCTLRKLAGDCGFADLEESLIRDQIILGLNDAKLTERLLKESTLTLDSCMKICKVAESAAKQVQVMTEKTVEAVTRKQESRSRMPNQNKTSFNNKQHLGKSAEGSVRLKNNNCERCGGVHSHRSCPAFGRRCAKCNRYGHYMQMCRTVGAVYVSDDDSDDSLVVGSVTVGQVDTEDWIVEAKVRGQKMKFKVDTGSQVNILTSAIVKKLDLKMTETCTKLKNFDGSTIETVGMTKTIVKFNKKKYVLDFYVVKFKTTNVLSYKAAVQLGLINKVENISKEYVVQDIGEYKDLFHGLGKLNYVYKIKLTDNCAPVVEPPRKIPFKLVDKVKNELDRLEQLDVIKKVQEPTEWVNSMAYLSKEREMSCEDTYWNKLWLTCTGDGTTE

Summary

EMBL
KK118858    KFM74040.1    MRZV01000519    PIK48493.1    HADY01023773    HAEJ01006887    + More
SBS47344.1    GCES01096219    JAQ90103.1    MRZV01000161    PIK56894.1    GGMR01000868    MBY13487.1    GBHO01031825    JAG11779.1    GCES01104253    JAQ82069.1    MRZV01000033    PIK61397.1    ABLF02013930    ABLF02013934    AERX01070080    GEZM01020000    JAV89472.1    MRZV01000618    PIK46835.1    GACK01009641    JAA55393.1    MRZV01000576    PIK47528.1    GBHO01036465    JAG07139.1    GEZM01079607    GEZM01079598    JAV62391.1    AGBW02008504    OWR53150.1    GEGO01004362    JAR91042.1    HADZ01022257    SBP86198.1    GEZM01016880    JAV91071.1    GEZM01051395    JAV74977.1    GEZM01050997    GEZM01050995    JAV75219.1    GEZM01102055    GEZM01102054    GEZM01102053    GEZM01102051    JAV52011.1    ABLF02010707    GGMR01004179    MBY16798.1    GEZM01001973    JAV97431.1    HAED01014930    SBR01375.1    GEZM01041944    JAV80090.1    ABLF02038957    GEZM01066276    JAV68015.1    NCKU01019406    RWR98729.1    GEZM01097791    JAV54106.1    ABLF02041541    GEGO01004665    JAR90739.1    AERX01076149    GDKW01000526    JAI56069.1    KF319019    AIE48224.1    ABLF02008456    GBGD01000115    JAC88774.1    ABLF02007384    GBGD01000119    JAC88770.1    ABLF02019772    CM012440    RVE73710.1    GFWV01003962    MAA28692.1    GEFM01002416    JAP73380.1    GCES01030230    JAR56093.1    CM012446    RVE67610.1    KK122208    KFM82237.1    GBBI01004745    JAC13967.1    MRZV01000718    PIK45343.1    GEZM01035137    JAV83383.1    AAGJ04086364    AAGJ04086365    ABLF02022355    ABLF02022359    ABLF02022361    ABLF02022365    ABLF02041467    GEFM01002429    JAP73367.1    LSMT01000199    PFX23692.1    HAED01002821    SBQ88678.1    GEZM01011167    JAV93617.1    LBMM01012476    KMQ86207.1    NIVC01004071    NIVC01003836    NIVC01003668    PAA48739.1    PAA49587.1    PAA50326.1    HAEJ01014648    SBS55105.1    HADZ01020631    HADZ01021503    HAEA01008283    HAEA01008803    SBP84572.1    SBP85444.1    AAGJ04028399    AAGJ04028400   
Pfam
PF00078   RVT_1        + More
PF17921   Integrase_H2C2
PF17919   RT_RNaseH_2
PF00665   rve
PF03732   Retrotrans_gag
PF13330   Mucin2_WxxW
PF17917   RT_RNaseH
Interpro
IPR021109   Peptidase_aspartic_dom_sf        + More
IPR000477   RT_dom       
IPR001584   Integrase_cat-core       
IPR041577   RT_RNaseH_2       
IPR001878   Znf_CCHC       
IPR012337   RNaseH-like_sf       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR001995   Peptidase_A2_cat       
IPR005162   Retrotrans_gag_dom       
IPR001969   Aspartic_peptidase_AS       
IPR036875   Znf_CCHC_sf       
IPR000679   Znf_GATA       
IPR007110   Ig-like_dom       
IPR013320   ConA-like_dom_sf       
IPR025155   WxxW_domain       
IPR041373   RT_RNaseH       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF57756   SSF57756       
SSF49899   SSF49899       
Gene 3D

Ontologies

Topology

Length:
497
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01467
Exp number, first 60 AAs:
0.0092
Total prob of N-in:
0.00078
outside
1  -  497
 
 

Population Genetic Test Statistics

Pi
139.213354
Theta
148.671973
Tajima's D
0.181425
CLR
1.773981
CSRT
0.420178991050447
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号