SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10342
Pre Gene Modal
BGIBMGA007228
Annotation
potassium_coupled_amino_acid_transporter_[Manduca_sexta]
Full name
Transporter       + More
Sodium-dependent nutrient amino acid transporter 1      
Location in the cell
PlasmaMembrane   Reliability : 4.949
 

Sequence

CDS
ATGAGTCAAACACATGTGAACAATGGGTTCGACATGTCCTCGGAGAATCCTCCGACGGACAGGGACCCGTCATTGAATCGTCCAGGATCACCCAAGCCGAAGCGATCCACAAAACCTGATCTACCTCCTCCGGCACTGAAGGTTCCAGTCAATGAAAAGAAGGCTTTCGAAGATATAGAAGGTGCTCCTGAACGTATGATGTGGTCTAATCAAATTGAATTCCTCATGTCGTGCATCGCTACATCAGTGGGCTTAGGCAACGTATGGCGGTTTCCATTCGTTGCATATCAAAATGGCGGCGGGGCCTTCCTTATACCCTATATCATAGTGTTGTTTTTAGTCGGCAAACCCATGTACTACCTCGAATGTGTTTTGGGACAGTTTAGTTCGAGAAATTCTGTCAAAGTTTGGTCTTTATCACCAGCAATGAAAGGAACCGGCTATGCTCAAGCTTTGGGTTGCGGATACATCCTATCTTACTACGTAGTAATTGTTGGTCTATGCCTGTATTATTTGTCAATGAGTTTCCAGTCTACACTGCCATGGGCTGTTTGTGAACCTGGTTGGGAAAACTGCGTGCCTTCGGATCCTAACAGTGCCCCAGTTGGAACCGTAGTCAACGGCACCAGTAGCGCGGAGCTTTACTTCTTGAGAACAGTTCTTCAGCAAAGCGATGGTATCGAAGGCGGACTCGGCGCTCCTATATGGTACCTGACCTTATGTTTGCTCGCAACGTGGGTGATTATTTTTGTCATCGTCGCACAAGGCGTGAAGAGTTCTGGCAAGGCTGCATACTTCCTAGCTTTGTTCCCCTATGTCGTTATGATCATATTGTTCATAACGACTGTAATTTTACCCGGAGCTGGTACGGGAATCCTCTTCTTCATAACGCCTCAATGGAGTAAACTATTAGAGTTAGACGTATGGTATGCTGCAGTAACGCAAGTATTCTTCTCGTTAACAGTTTGCACTGGAGCTATCATCATGTTCTCATCCTATAATGGTTTCAAACAAAATGTCTACAGAGATGCAATGATTGTTACAACTTTGGACACCCTCACAAGTTTGCTATCCGGCTTTACTATTTTCGGTATCCTCGGTAACTTGGCTAATGAACTAAATTCTCGAGTAGAAGATGTGGTCGGCTCTGGAGGAACCGGACTAGCTTTCATCTCGTACCCTGACGCCATTGCAAAAACGTTCATGCCACAGTTGTTCTCAGTTCTGTTCTTCCTGATGATGGCTGTGCTGGGTGTGGGTTCATCTGTGGCTCTTTTGTCGACCATCAACACTGTAGTGATGGACGCTTTCCCCAACGTTCCCACAGTGTTCATGTCGGCTCTCTGCTGTACCGTTGGATTTTTAGTGGGACTTGTTTACGTCACACCTGGTGGACAATATATATTGGAGCTTGTCGATTACTACGGTGGAACGTTTTTAGTATTATTCTGCGCCATTGCTGAAATTATTGGTGTATTCTGGATATACGGCTTAGAGAATCTGTGCCTCGACATCGAATACATGTTGGATATAAAGACGTCTCCTTACTGGCGCATGTGTTGGGGTCTGATCACGCCAGCCATGATGATTATTGTATTCCTGTACGCACTGATTTCATACGAAGCATTGCTCTTCGGAGGAATGGCCGGATATGTGGCTGGTTACCTGTTGTTGATCGTGGGTATTTTGTTGGTACCGATTTCCATCTGCCTTACATTGTACAAGTACAGGACTGGAAACTTCATTGAGACTCTAAAGCTTTCTTTCCGCTCCAAGGAATCTTGGGGTCCAAGATCAGCTGGCGAACGCAGAACCTGGCTTTCATTTAAAGAAGACGCGAAAGTATTACGAGAAAAACTTAATCCCTCACGAATCACGCATGTCTGGTATAGTTTAATAGGAAGCTACAGACGACGAATCTAA
Protein
MSQTHVNNGFDMSSENPPTDRDPSLNRPGSPKPKRSTKPDLPPPALKVPVNEKKAFEDIEGAPERMMWSNQIEFLMSCIATSVGLGNVWRFPFVAYQNGGGAFLIPYIIVLFLVGKPMYYLECVLGQFSSRNSVKVWSLSPAMKGTGYAQALGCGYILSYYVVIVGLCLYYLSMSFQSTLPWAVCEPGWENCVPSDPNSAPVGTVVNGTSSAELYFLRTVLQQSDGIEGGLGAPIWYLTLCLLATWVIIFVIVAQGVKSSGKAAYFLALFPYVVMIILFITTVILPGAGTGILFFITPQWSKLLELDVWYAAVTQVFFSLTVCTGAIIMFSSYNGFKQNVYRDAMIVTTLDTLTSLLSGFTIFGILGNLANELNSRVEDVVGSGGTGLAFISYPDAIAKTFMPQLFSVLFFLMMAVLGVGSSVALLSTINTVVMDAFPNVPTVFMSALCCTVGFLVGLVYVTPGGQYILELVDYYGGTFLVLFCAIAEIIGVFWIYGLENLCLDIEYMLDIKTSPYWRMCWGLITPAMMIIVFLYALISYEALLFGGMAGYVAGYLLLIVGILLVPISICLTLYKYRTGNFIETLKLSFRSKESWGPRSAGERRTWLSFKEDAKVLREKLNPSRITHVWYSLIGSYRRRI

Summary

Description
Unusual broad substrate spectrum amino acid:sodium cotransporter that promotes absorption of the D isomers of essential amino acids. Neutral amino acids are the preferred substrates, especially methionine and phenylalanine (By similarity).
Unusual broad substrate spectrum amino acid:sodium cotransporter that promotes absorption of the D isomers of essential amino acids. Neutral amino acids are the preferred substrates, especially methionine and phenylalanine.
Similarity
Belongs to the sodium:neurotransmitter symporter (SNF) (TC 2.A.22) family.
Keywords
Amino-acid transport   Complete proteome   Glycoprotein   Ion transport   Membrane   Sodium   Sodium transport   Symport   Transmembrane   Transmembrane helix   Transport   Reference proteome  
Feature
chain  Sodium-dependent nutrient amino acid transporter 1
EMBL
BABH01039076    BABH01039077    BABH01039078    BABH01039079    AF006063    AAC24190.1    + More
AF013963    AAF18560.1    KQ461155    KPJ08125.1    KQ459232    KPJ02811.1    ODYU01004070    SOQ43560.1    NWSH01000569    PCG75591.1    NWSH01000921    PCG73531.1    GDQN01011140    JAT79914.1    AB365597    BAG39453.1    RSAL01000036    RVE51256.1    PCG73535.1    PCG73534.1    PCG73532.1    PCG73533.1    SOQ43562.1    AGBW02014242    OWR42034.1    GDQN01004191    GDQN01000328    JAT86863.1    JAT90726.1    GDQN01010095    JAT80959.1    OWR42035.1    NEVH01024531    PNF16994.1    PNF16938.1    KQ414608    KOC69394.1    KQ763581    OAD54951.1    GFDL01000068    JAV34977.1    NNAY01001443    OXU23962.1    AY330296    AAR08269.1    DS235282    EEB14370.1    CH954180    EDV45889.1    CH477509    EAT39788.1    JXJN01008983    EJY57747.1    AF543193    AAN40410.1    KK852489    KDR22766.1    GDAI01001449    JAI16154.1    GANO01002161    JAB57710.1    KQ980762    KYN13552.1    CVRI01000017    CRK90243.1    CH964239    EDW81840.1    CH479193    EDW26724.1    CH933814    EDW05515.1    KQ971361    EFA08708.1    OAD54950.1    QOIP01000006    RLU21298.1    CM000162    EDX01121.1    CM000366    EDX17133.1    JRES01001335    KNC23567.1    CH940664    EDW62937.1    OUUW01000003    SPP78406.1    KZ288308    PBC28721.1    CH379064    EAL32192.1    BT099637    ACU68946.1    PBC28724.1    GBXI01000417    JAD13875.1    DQ073009    AE014298    AY121662    AAF46031.2    AAM51989.1    UFQS01000248    UFQT01000248    SSX01993.1    SSX22370.1    QOIP01000004    RLU23635.1    GL443425    EFN62065.1    GL450241    EFN81283.1    ADTU01020082    ADTU01020083    ADTU01020084    ADTU01020085    ADTU01020086    ADTU01020087    ADTU01020088    ADTU01020089    ADTU01020090    ADTU01020091    JXJN01008984    GDHF01016852    JAI35462.1    SSX01994.1    SSX22371.1    GDIQ01033961    JAN60776.1    GFDF01007320    JAV06764.1    GFDF01007322    JAV06762.1    JXUM01010513    KQ560310    KXJ83117.1    GDIQ01245340    JAK06385.1    SSX01995.1    SSX22372.1    AJVK01014254    KQ982205    KYQ59002.1    GDIQ01028602    JAN66135.1    GFDF01007321    JAV06763.1    GDIP01186721    LRGB01001348    JAJ36681.1    KZS12914.1    CM000071    EDY68808.1    KQ435689    KOX81270.1    KRT01700.1    CP012524    ALC41841.1    OUUW01000001    SPP75127.1    GDIQ01101096    JAL50630.1    GL732535    EFX84094.1    GAKP01004550    JAC54402.1    JXUM01067031    JXUM01067032    JXUM01067033    JXUM01067034    JXUM01067035    JXUM01067036    KQ562429    KXJ75930.1    GBXI01003895    JAD10397.1    SPP75128.1    CH479181    EDW31701.1    CP012528    ALC48305.1    ADTU01019952    ADTU01019953    ADTU01019954    ADTU01019955    ADTU01019956    ADTU01019957    ADTU01019958    ADTU01019959    ADTU01019960    ADTU01019961   
Pfam
PF00209   SNF        + More
PF00246   Peptidase_M14
Interpro
IPR000175   Na/ntran_symport        + More
IPR037272   SNS_sf       
IPR000834   Peptidase_M14       
SUPFAM
SSF161070   SSF161070       
PDB
4XPT     E-value=2.46203e-90,     Score=849

Ontologies

Topology

Subcellular location
Membrane  
Length:
640
Number of predicted TMHs:
12
Exp number of AAs in TMHs:
266.98648
Exp number, first 60 AAs:
0
Total prob of N-in:
0.68319
inside
1  -  73
TMhelix
74  -  93
outside
94  -  102
TMhelix
103  -  125
inside
126  -  151
TMhelix
152  -  174
outside
175  -  234
TMhelix
235  -  257
inside
258  -  263
TMhelix
264  -  296
outside
297  -  310
TMhelix
311  -  333
inside
334  -  344
TMhelix
345  -  367
outside
368  -  403
TMhelix
404  -  426
inside
427  -  438
TMhelix
439  -  461
outside
462  -  475
TMhelix
476  -  498
inside
499  -  518
TMhelix
519  -  541
outside
542  -  550
TMhelix
551  -  573
inside
574  -  640
 
 

Population Genetic Test Statistics

Pi
208.413179
Theta
174.320169
Tajima's D
0.689516
CLR
0.073049
CSRT
0.565871706414679
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号