SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10340
Annotation
hypothetical_protein_TcasGA2_TC034535_[Tribolium_castaneum]
Location in the cell
Nuclear   Reliability : 2.783
 

Sequence

CDS
ATGCCGCCGCGAAAAATACGCCAACAGACGGATGACAATAGTGATTCTGGTGATGAAAAGGTGGACGCAGTGCCCTCGCCAGCACCAGTGCTCATGTCCGGGGATCAGCTGTCCTCGCTCCTGGCCGCCTTCTCAAAGTCGCAGGCCGAGGCGAACCGACAACTCGTCGAGTCCCTGTGGGCATCGCATGGTTTGGGAAGTGGATCGAAGTTCACCACCCCGATAGTGTCACCGTCCCCGACGCCAACAAGTAACATGGCTAAATGCACCGCGCGTTTTGATGGCGTCGCTCGCGATCCGGAGGCCGTTGAAGCGTTTATCGACTCTGTGGAGGTGTACAAGGAGTGTGCGTGCGTCTCCGACGATATCGCATTGCGTGGACTACCAATGCTCATGGAAGGCGAAGCAGCCATATGGTGGAGAGGGGTCCGGAACGAAGTGTCCTCGTGGCCCGACGCTCTCAAAAGGTTACGAGCTATGTATGGTGTGCCACGCCCTGCACATAAAGTTTTTCGTGACGTGTTTTCGTCTGAGCAAGGTGATGAGCTTGCTGACAGTTTCATAGTGAGGATACGTGCTATGCTGTCCAGATTGCCGTACCAGCTACCAGAGGAAGCCAGGTTAGACATAATCTACGGTCTACTTCATAAACGGATAAGGAAAAGACTACCGAGAGATGGTGTGAGCGACATAGAAACACTCATAGAGAAGTCGCGCATGGTGGAGGAGTCACTTGTGGAGTGCGCGGCTGCCCTCAACATTCCGCCGCAGCCACACAAGTCGTTACCTACGGTGTTCGGCGAACGCAGCTCCGCGCCTGACGTGACAAGTGTGAGATCGCCGAGACCTGCCGGCGCTGCCGCTGCGCTAGTGCGCTCCTCCGTTGCTGTTGCACCGTCGTCGCTACCTCAACCGTCCCCATCCCCGCGTAGTGTGAAAAGCGAAACATTGGTTAAAAAGCTATTTTGTGTGTATTGCAAATCGCGTGGACATGTCCGTGATTCTTGTAACAAAATTAGTGAAAACAAATCTGTATCTTGTTATGGTTGTGGTGAAAAAGGTTTTATTAAAAGTAACTGTCCAAAATGTAACAATATTCCTAGCAATATTCAGAGTAATGTTAATAATAGAAACTCGCACGTTAAGGACAATGTATTCTATTCTGTAAATGTAAACACTTTCTCAGATTCACATTGTAATGATAAACATTCTGTAAGTCGACCTATATTGCATATAGGTATACAGGGTTATAATGGGACTGCTTTGTTAGATAGCGCCGCACGGCGTAGTATCGCGGGTTACACACTCTACGCGCTTTTTCAACGTTTAGGTATGAAGTTTCGCACTGAAAATATGTCGGTGAAACTCGCGGATGGTACCACTCGGAACACTAAGATATTATTAACACATGCAGACGTTGAATTAAGTTCAGTATGTATACCTATTGAGTTTATTATATTCCCCGATTCTCAGAATAATGAAACCTTGTTAGGAATAGATTTTATTTTGAAGGCACGATTAATAATTGATTTCTCTTCTATGACTTGGCGCTCGGCTGATCAGCCCCGGGACATTCACCCTTTGACATGTGAAAATTCACGTGACCCCATAAGTTGCGCTTCTATAAACTTGTTGCGCGAGGATGAAGGCAAATTCTTATCGGAGTCGGAAAAGGGGCGTCTGGTGGATTTGCTAGGTGAATATACTGATGTTTTCGAGGAAGTCGGTGAGCCGACTCCTTTTTCAGAGCATCGGATCGACACCGGCGACCACCCTCCTATCGCTGTACCTCCGTATCGTGTCACGCCGGCGAGGAAAGAGGTCATGCGCGCCGAGCTCGACAAGATGCTAGCAGAGGACGTGATCGAGGAATGTGAGTCTGCGTGGTCCGCGCCGTGTGTCTTGGTGCCGAAACCTAACGGTACGTATAGGTTTTGTGTTGATTATAGGAAACTGAATGCGGTCACCAAGACCGATTCCTATCCCATGCCTCGAATTGATGAACTTCTTCAGTCTACCAATGGAGGTTGCGTTATGAGCTCGTTGGATCTTCGGAGCGGGTACTGGCAGGTTCAAACCCTGGAGCAGGATGATGCCTTCAAATCTCTTAAGACGCTACTGACGACATCTCCGATTTTGGTACAGGCAGACTATACTAACCCTTTCATCCTTAGGACTGACGCGAGTGATTATGCTCTAGGTGCATGTTTGCTCCAGGGGGAGTCATCCAATGATGAGCGTCCCATTGAGTACGCCAGTCGTCTTCTGACATCGGCGGAGCGCAACTATTCGACGACCGAACGGGAGGCGCTCGCTGTCGTCTGGGCTGTGGAGCGATTCCGAGGCTACATCGATGGACATCTGGTGCACGTTCGTAGTGACCATCAGCCCCTGAAATGGTTGTTTTCAGTAAAGTCACCGAGCGGCAGGTTAGTTCGCTGGGCTATGAAGCTTCAAGCTTACGATTTGCAAATTGAGTACACCCCAGGAAAAGTTAATGTGATAGCCGACACGCTTAGCCGCCCAGTGACCGAGCTCAACTCGCCACCGGACTGTGGAATCTGTCCCGTTATCGTCGATGTGCCCCACTGGGATGCCGCTTCGACCCGGGACGCTCAGATGGCTGATCCGGAAATTTCCAAGATCATCATTGATTTGGAAGGGACCGATGAATTATCTGTTAATAGATGGTCTGAACGAGGCTATCTCCTAACTCAAGGCGTTCTATACCGCTACGCCGAAGATTCTGAGTCCGAGGAACCTCAGCTAGTCGCACCAGAGAGCTTGCGTGGCAAGGTCATGTTCGAGTGTCATGACTCGCCCACAGCCGCTCACGGGGGGATTCAAAAGACCATTCATCGTATCTCCCAACGATTCTATTTTCCAGGTTTGAGACGCTATGTTACTGAGTATTTGAAAACGTGTATAGAGTGCCAGCGGTACAAGCCGTCTAACTTTAAGCCAGCGGGACTACTCCAGACTCCAGTTCCAGCTCAGCGGTTTGAAGTTATTGCAGTGGACCTTTTCGGGCCTTTACCCAAAGGACCCTGCGGTGAGAGGTGGATCCTGATAGTCGAAGACACCGCCAGTAAGTGGGTTGAGCTGTTCGCTCTCATTGATGCCACTGCCGAGGTATGTGCAAAAACCCTCGTTAATGAAGTCTTTATGAGATTCGGAGTGCCTCGCCGGATGATTTCCGACAACGGAGTTCAATTTGTGGCCGATGTCATGCAAAAGGCTATGTTTGTTTTAGGGGTAAAACAAAATCTCATTCCTCTTTATCATCCCGAAGCCAATCCGGTTGAGCGGAAGAATCGGGACTTAAAGGCTCATCTTGCCATATTGCTTGAAGGCCGTCACCAGCAGTGGCCTGAGGTACTGTCGTTCGTCCGATTCGCTTTTAATAGTTCCGTCTGCACGTCAACCGAGCAAACGCCAGCTTATCTTACCTTTGGTCGTGAGCTCCGATCTCCAATATCCGCTCAGCTTGATCTTCGCGCCGTCGTAGAGTCCGAGAACTTTGTTCCCCAGATAAGCCCATATTTGTCCAAGCTTGCCGAGACCATCTCGACCGCTAAGGAGAATATTGAACATCATCAAGATATTCAAAAGACGCGCGCTGATCTAAGGCGCTCTGAACCTTACCAGTTTGCAGAAGGGGATCTCGTATTGATGAAGACCCACGTACTTAGTAATGCTAGTAAGGGTATTACGTCGAAGTTTAATCCTAAGCGGGATGGGCCATATGTGATTTCAAAAAAGGTGAGTCCTACTTCCTACCTTCTAGCATACGAGTCGTCGGGCGAAGTTTTTGGTAAGTATCATGTCTCGGATTTGCGACCTTATCATGCGAGGGAGGATGTATGTCCCGAGCCTGTGATTCCCAAGCGCCGCCGGGGTCGACCGCGTAGGGTGGTGGAGTAG
Protein
MPPRKIRQQTDDNSDSGDEKVDAVPSPAPVLMSGDQLSSLLAAFSKSQAEANRQLVESLWASHGLGSGSKFTTPIVSPSPTPTSNMAKCTARFDGVARDPEAVEAFIDSVEVYKECACVSDDIALRGLPMLMEGEAAIWWRGVRNEVSSWPDALKRLRAMYGVPRPAHKVFRDVFSSEQGDELADSFIVRIRAMLSRLPYQLPEEARLDIIYGLLHKRIRKRLPRDGVSDIETLIEKSRMVEESLVECAAALNIPPQPHKSLPTVFGERSSAPDVTSVRSPRPAGAAAALVRSSVAVAPSSLPQPSPSPRSVKSETLVKKLFCVYCKSRGHVRDSCNKISENKSVSCYGCGEKGFIKSNCPKCNNIPSNIQSNVNNRNSHVKDNVFYSVNVNTFSDSHCNDKHSVSRPILHIGIQGYNGTALLDSAARRSIAGYTLYALFQRLGMKFRTENMSVKLADGTTRNTKILLTHADVELSSVCIPIEFIIFPDSQNNETLLGIDFILKARLIIDFSSMTWRSADQPRDIHPLTCENSRDPISCASINLLREDEGKFLSESEKGRLVDLLGEYTDVFEEVGEPTPFSEHRIDTGDHPPIAVPPYRVTPARKEVMRAELDKMLAEDVIEECESAWSAPCVLVPKPNGTYRFCVDYRKLNAVTKTDSYPMPRIDELLQSTNGGCVMSSLDLRSGYWQVQTLEQDDAFKSLKTLLTTSPILVQADYTNPFILRTDASDYALGACLLQGESSNDERPIEYASRLLTSAERNYSTTEREALAVVWAVERFRGYIDGHLVHVRSDHQPLKWLFSVKSPSGRLVRWAMKLQAYDLQIEYTPGKVNVIADTLSRPVTELNSPPDCGICPVIVDVPHWDAASTRDAQMADPEISKIIIDLEGTDELSVNRWSERGYLLTQGVLYRYAEDSESEEPQLVAPESLRGKVMFECHDSPTAAHGGIQKTIHRISQRFYFPGLRRYVTEYLKTCIECQRYKPSNFKPAGLLQTPVPAQRFEVIAVDLFGPLPKGPCGERWILIVEDTASKWVELFALIDATAEVCAKTLVNEVFMRFGVPRRMISDNGVQFVADVMQKAMFVLGVKQNLIPLYHPEANPVERKNRDLKAHLAILLEGRHQQWPEVLSFVRFAFNSSVCTSTEQTPAYLTFGRELRSPISAQLDLRAVVESENFVPQISPYLSKLAETISTAKENIEHHQDIQKTRADLRRSEPYQFAEGDLVLMKTHVLSNASKGITSKFNPKRDGPYVISKKVSPTSYLLAYESSGEVFGKYHVSDLRPYHAREDVCPEPVIPKRRRGRPRRVVE

Summary

Pfam
PF17921   Integrase_H2C2        + More
PF00078   RVT_1
PF00098   zf-CCHC
PF17917   RT_RNaseH
PF00665   rve
Interpro
IPR021109   Peptidase_aspartic_dom_sf        + More
IPR000477   RT_dom       
IPR041373   RT_RNaseH       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR001969   Aspartic_peptidase_AS       
IPR001584   Integrase_cat-core       
IPR012337   RNaseH-like_sf       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF57756   SSF57756       
Gene 3D
ProteinModelPortal
PDB
4BAC     E-value=9.88681e-23,     Score=269

Ontologies

Topology

Length:
1307
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00373000000000001
Exp number, first 60 AAs:
0.00046
Total prob of N-in:
0.00016
outside
1  -  1307
 
 

Population Genetic Test Statistics

Pi
229.267311
Theta
195.929161
Tajima's D
2.109244
CLR
0.296517
CSRT
0.896205189740513
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号