SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10322
Pre Gene Modal
BGIBMGA007221
Annotation
ATP-binding_cassette_sub-family_A_ABCA1_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 2.898
 

Sequence

CDS
ATGAGATATTTAGTGCCGCCCAAAGCAATACCGGCTAAAACTTACACATCCTTTGATGTCACCTATTTCAATAAGACAAGGGGAAATCTGTCATCAGCTGACATGGTATTGGCATACTCACCAATAAATCAATTGACTGAAAAAGTTGCAATCAATGCTATGGCTGAACTTGCTCGAGATTCAATTGATCCTGATATATTTTTTTTTATATCACTTGCAATTTCATACACTCCTAAAGGATATAAAAATGCCAAAGATATGGAAGCAGCACTAATACAGCCCAATGCTATGAATAGCATTTTGCTTGGTATACAATTTGATGATGAAATCGCTAATGCTACGTCTTGGCCAGATGATATAAAAATAACTTTTAGGTTTCCTGCTGTTATGAGATCGACAACGTCTGATCATCAAATGCAATTGAGCTGGCAAACAAACTTACTATTTCCATTGTTTCCGAATTCTGGTCCACGAGAACCAGATGATCAATATGGAGGAACTTCGCCAGGTTACTTCTCGGAACTATTCTTGTTCATGCAGCACGCAATTTCCAAAAGCATCGTAAAAGAGAAGACCGGGAAAAACATTGATACCAAAATATATCTACAGCGTTTACCTCAACTTGAATCTAGGGTGGATCAGCTACTGTTCATTTTACAAAGATTTGTATCCATAGCTATAATGCTGGGCTTCGTCTATACATTCGTGAATACAGTCAGGGCTGTCACAACTGAGAAAGAACTGCAGCTAAAGGAAACAATGGCAATTATGGGTCTACCGTCTTGGCTGCACTGGTTAGCGTGGTTCATCAAACAATTTTCATTCTTACTTGTGACTATTGTCATAATGGTTATATTGTTTAAGATTCCGTTATCCGAAACTGAAACAGGAGTGTCGTACTCCGTGTTCACCTACACGCCGTGGTCGGTCCTTTTATTCTTTTTGATTCTATTCGTCATTGCATCATTGACATTCTCTTTTATGATAAGCGTTTTCTTCACTAGAGCAAACACCGCCGCGTCTTTTATGGCTCTCATATGGTTCGCAACGTTCGCAGTCTTTATGTTCACCCAAATGATTAACGAGACCATGTCTGCCCCAGTTAAAATAACACTATGTTTGTTATCAAACACTGCCATTGGATACGCATTCCAGATGATTATCATTGCCGAAGGAACGATGCAAGGTTTACAATGGGCCAATTTCTTTGAGCCGATATCGTACAGTGAAAACTTTCAACCGGCTCATGTAGCCTTCATGCTAATATTGGACTCCGTGATGTACATGGCGATCGCCGTGTATGTGGAGAACATACGACCCGGAATGTACGGAGTGCCGTTGCCTTGGTACTATCCTTTCACTGTTAGTTATTGGTGGCCGAACAGAATATCTGACACAAATCGAGAGAAAACATCTGACGATCTTGAATATAATGATGCATTATTGTCGGTGGTACACGACGAGGAACCCAAAGGCGTTCCCATTGGCGTAAACATTCAAAATCTCACAAAAAGATATAAGGGACGGGGGAAAGCTGTCGATAATTTAAATCTTAGACTTTATGAAAACGAGATTACAGTACTTCTGGGTCACAATGGAGCGGGGAAAACGACAACGATTTCTATGTTAACAGGAATGGTCCCTCCAACATCAGGATCGGTAACGATCAATGGATATGATATCGTGACGGAAACGGAAAAAGCTAGACGTTCTCTTGGAATATGTCCTCAACATAATGTACTGTTCCCTGACCTGACCGTAGCTGAACATTTAATTTTTTATTCAAAGCTAAAGGGGATTCCCGAATCAGAAATCAATGAAGAAATAGATCATTTCGTCAAACTTCTCGAATTGGATGACAAGAGGCACGCGGCGGCATCGAGTCTGTCGGGCGGGCAGAAGCGGCGGCTGTCGGCGGGCTGCGCGCTGTGCGGGCGCTCGCGCGTGGTGCTGCTGGACGAGCCCACGTCGGGCCTGGACCCGGCGGCGCGGCGCGCGCTGTGGGACCTGCTGCAGCGCGAGAAGCGCGGCCGCACCGTGCTGCTGACCACGCACTTCATGGACGAGGCGGACGTGCTGGCCGACCGCGTGGCCGTGCTCGCCGCCGGCCGCCTGGCCTGTCTGGGCTCCCCCTACTTCCTCAAGCGCCACTACGGACTCGGCTACAAGCTCGCGCTCGTCAAGGACGCCGCCTGCCAAGTCGATCTTGTCACGGAATTCTTCAAAACATATGTCCCTAATCTCAAGCAAAATTCAAATATCGGCTCAGAATTAACTTACATTTTACCTAGTGAGAGTGTAAGTAAATTTCCCGAAATGCTCAAAAAACTTGAAGAAAAGAAAGAGTCTTTATGTATATCAAGCTACGGGTTATCAGTGACTAGCCTTGAGGAAGTTTTTATGAAAGCTGGAATCGAAGATAACAATGTTGAAATAAAAGAAACTAAAGGAGATATCGAAATGATTGATATGAATGGGGACATGTTGAAGGACAATGAGCCTTTACATAAAACGCAAGGGTTTCATTTACTGAAGAATCACATAAAAGCTATGTTCTTGAAACTGATGTACAACACATTGAGAAATAAGGCACTCGCTGCGATACAAATAATATGGCCAATAATAAACATTATTTTATCGATGATAGTTTCACTATCTTGGAAATTCTTGAATGTATTGCCCCCGCTTGAACTAAGCCTGGAGAGTGGATTTAAAGGAACCGAGACATTAGTATCGCAAGGTAACGATTTGAGAGACGGCAGTACTGAAGCTAATGTCATGATGGCATACAAAGATTATTTCAAACGATCAACGTACCCCGGCTTGAAGTTATTGGATGTCGGAACTTCTAACTTAAAAAACGTCTATTTGAAACTTATCGCAGAAGATCAATCTCGAGTACGATATGAAGATCTAGTGGGAGCTACATTTCGTAATAACAGCATAACAGCCTGGTTCAGTAACTACGGTCTTCATGATTCTGCTATCTCGCTTTCACTAGTCGAGAACGCAATAATTCGTTCTCTGTCACCCAATACAACTTTGACATTTGTCAACCATCCGCTACCATATTCAGTTGAAGGAATGGTTCAAGTAATGTCTACCGGAACAAACACCGCCTTCATGTTTTCTTTTAGCCTGGGATTTTGTATAGCGGTTATAAGCTCTTTTCTGGTTCTCTTTGTAATTAAAGAGCGCATCAGCGGTGCGAAACTTCTCCAAAGAGTATCAGGAGTGCGACCGGTAGTAATGTGGAGTACTGCCCTCATTTGGGATTGGATTTGGTTGTTTCTGAACCACATTTGCATTATAGTCACTATTGCGTGCTTCCAAGAAATGGGAATGTCGACGCCTGCTGAACTTGGTCGAATTTTATTAGTTCTGATGGTGTTTTCATTGGCAATTATACCGTTGCACTACCTCGCATCGTTCTGTTTCGAAGAAGCCGCCACCGGTTTCAGTAAAATGGTGTTTGTAAATATATTTTGTGGTTCAATGTTGTTCCTTGTCACTGAAGTATTACGGATGCCTTTCATAAATGCTGCTGCTTACGCAGAAATACTTGAGTATCCATTTTCATTGTTACCAATCTACTGTGTCAGCAAGAGTGTCAGGGAAATGGTGACATCTTCAATAAAGATTAAAGCCTGCGACAGCTTATGCAACCAATTAAATTATAAAAATTGCACACGACTAACTATATGCAATGAACTAGACATATCCATGTGTTGTATTGAGGATAATCCATTTTTAGGGTGGAAGGAACCGGGTATTGCAAGATATCTATTTACTATGATAGTTGTAGCGACTGTGTCATTTGCAATATTGCTAGCCAAGGAATACGAACTTTGGAACAAGGTCTTGTACAAGAAACAAGAAGAGACTATGATGTTATCTGGTACAAAACCAAAATCTAATGAGAGTAAAAAGGTTGAAGTAAATGCAGAAGTTGAAGATGATGATGTTGTGGAGGAAAAACAGCGTGTTCTAGCAATGACAAGTAGTGAGGTCACCGCACACAGCCTCGTGTGTCGCGAGCTGAGCAAGCGCTACCGGCGCCTCGTAGCCGTCGACCGACTCACGTTCGCGGTGCGCGGCGGAGAGTGCTTCGGCCTGCTCGGAGTCAACGGCGCCGGCAAGACCAGCACCTTCCGCATGCTGACCGGCGACGCACGCGTGTCGGACGGCGACGCGCTCGTGCACGGACACTCCGTGCGAGCACACGTGCAGGACGTGCACCGCCTCATTGGTGAGTCGACCCTATTACACCTCAGCTCGGTCCGCATGCTGACCGGCGACGCACGCGTGTCGGACGGCGACGCGCTCATGCACGGACACTCCGTGCGAGCACACGTGCAGGACGTGCACCGCCTCATTGGTGAGTCGACCCTATTACACCTCAGCTCGGTCCGCATGCTGACCGGCGACGCACGCGTGTCGGACGGCGACGCGCTCGTGCACGGACACTCGGTGCGAGCACACGTCTCGGTTCGCATGCTGACCGGCGACGCACGCGTGTCGGACGGCGACGCGCTCGTGCACGGACACTCCGTGCGAGCACACGTGCAGGACGTGCACCGCCTCATTGGTGAGTCGACCCTATTACACCTCAGCTCGGTCCGCATGCTGACCGGCGACGCACGCGTGTCGGACGGCGACGCGCTCATGCACGGACACTCCGTGCGAGCACACGTGCAGGACGTGCACCGCCTCATTGGTGAGTCGACCCTATTACACCTCAGCTCGGTCCGCATGCTGACCGGCGACGCACGCGTGTCGGACGGCGACGCGCTCGTGCACGGACACTCGGTGCGAGCACACGTCTCGGTTCGCATGCTGACCGGCGACGCACGCGTGTCGGACGGCGACGCGCTCGTGTACGGACACTCGGTGCGAGCACACGTGCAGGACGTGTACCGCCTCATTGGTGAGTCGACCCTATTACACCTCAGCTCAGTCCGTATGCTGACTGGCGACGCACGCGTGTCGGACGGCGACGCGCTCGTGCACGGACACTCGGTGCGAGCACACGTGCAGGACGTGCACCGCCTCATTGGTGAGTCGACCCTATTACACCTCAGCTCGGTCCGCATGCTGACCGGCGACGCACGCGTGTCGGACGGCGACGCGCTCGTGCACGGACACTCGGTGCGAGCACACGTGCAGGACGTGCACCGCCTCATTGGTGAGTCGACCCTATTACACCTCAGCTCGGTCCGTATGCTGACTGGCGACGCACGCGTGTCGGACGGCGACGCGCTCGTGCACGGACACTCGGTGCGAGCACACGTGCAGGACGTGCACCGCCTCATTGGTGAGTCGACCCTATTACACCTCAGCTCGATCCGTATGCTGACCGGCGACGCACGCGTGTCGGACGGCGACGCGCTCGTGCACGGACACTCGGTGCGAGCACACGTCTCGGTTCGCATGCTGACCGGCGACGCACGCGTGTCGGACGGCGACGCGCTCGTGTACGGACACTCGGTGCGAGCACACGTGCAGGACGTGCACCGCCTCATTGGTGAGTCGACCCTATTACACCTCAGCTCGGTCCGTATGCTGACTGGCGACGCACGCGTGTCGGACGGCGACGCGCTCGTGCACGGACACTCGGTGCGAGCACACGTGCAGGACGTGCACCGCCTCATTGGTGAGTCGACCCTATTACACCTCAGCTCGGTCCGCATGCTGACCGGCGACGCACGCGTGTCGGACGGCGACGCACGCGTGTCGGACGGCGACGCGCTCGTGCACGGACACTCGGTGCGAGCACACGTGCAGGACGTGCACCGCCTCATTGGTGAGTCGACCCTATTACACCTCAGCTCGGTCCGTATGCTGACTGGCGACGCACGCGTGTCGGACGGCGACGCGCTCGTGCACGGACACTCGGTGCGAGCACACGTGCAGGACGTGCACCGCCTCATTGGTGAGTCGACCCTATTACACCTCAGCTCGGTCCGCATGTTGACCGGCGACGCACGCGTGTCGGACGGCGACGCACGCGTGTCGGACGGCGACGCGCTCGTGCACGGACACTCGGTGCGAGCACACGTCTCGGTTCGCATGCTGACCGGCGACGCACGCGTGTCGGACGGCGACGCGCTCGTGTACGGACACTCGGTGCGAGCACACGTGCAGGACGTGCACCGCCTCATTGGTGAGTCGACCCTATTACACCTCAGCTCGGTCCACATGCTGATCGCCGACGCATGTGTGTGGGACGGCGACGCGCTCATGCACGGACCCTTGGTAAGAACCCACGTGCAGGACGTGTATTGCCTCATTTGTTACTGCCCCCAATTCGATGCACTGTTTGACAATTTAACCGCAAGGGAGATATTGAAGATTTTCTGTTTGCTGCGTGGCATTCCTACGTCAATAGGCGAAACTCATGCCATTCATCTTGCTAAACAATTGGGATTCATAAAGCACTATGACAAGAAGGTTCGGGAATGTAGTGGTGGAACAAAACGTAAAATCAGTACAGCGGTCGCGTTGCTCGGTGATTACCCAGTTATATTCCTGGATGAGCCTACGACAGGCATGGATCCGGCGTCGAAGCGGCTCGTGTGGCGCGGCATCAGCAGCGCGGTGGGCGGCGGGCGCAGCGTGGTGCTGACGTCACACAGCATGGAGGAGTGCGAGGCTCTCTGCTCCAAGCTCACCGTCATGGTCAACGGCAGGCTCTGCTGTCTCGGCTCGCTGCAACATCTCAAGAGCAAATTCTCACAGGGATACACAATAATCGTGAAATGTAAATCGGGTCCAAATCGAGACGCAGCAGTGCTAGACGTCCACAACTATATGACTACAAATTTTGTTGGTGCTAACCTCATCGAGACGTACCTGGGCATGAGCACGTACCACGTGTCGTCGGCGGGGCTGCCGTGGTGGCGCGTGTTCAGTGCGCTCGAACTAGCGCGGGACTCGCTGCCGCTTGATGACTACTCGGTCGCGCAGACAACACTCGAGCAAGTTTTCCTCGCATTTACAAAGCTCCAACGTCCTATAAATTAA
Protein
MRYLVPPKAIPAKTYTSFDVTYFNKTRGNLSSADMVLAYSPINQLTEKVAINAMAELARDSIDPDIFFFISLAISYTPKGYKNAKDMEAALIQPNAMNSILLGIQFDDEIANATSWPDDIKITFRFPAVMRSTTSDHQMQLSWQTNLLFPLFPNSGPREPDDQYGGTSPGYFSELFLFMQHAISKSIVKEKTGKNIDTKIYLQRLPQLESRVDQLLFILQRFVSIAIMLGFVYTFVNTVRAVTTEKELQLKETMAIMGLPSWLHWLAWFIKQFSFLLVTIVIMVILFKIPLSETETGVSYSVFTYTPWSVLLFFLILFVIASLTFSFMISVFFTRANTAASFMALIWFATFAVFMFTQMINETMSAPVKITLCLLSNTAIGYAFQMIIIAEGTMQGLQWANFFEPISYSENFQPAHVAFMLILDSVMYMAIAVYVENIRPGMYGVPLPWYYPFTVSYWWPNRISDTNREKTSDDLEYNDALLSVVHDEEPKGVPIGVNIQNLTKRYKGRGKAVDNLNLRLYENEITVLLGHNGAGKTTTISMLTGMVPPTSGSVTINGYDIVTETEKARRSLGICPQHNVLFPDLTVAEHLIFYSKLKGIPESEINEEIDHFVKLLELDDKRHAAASSLSGGQKRRLSAGCALCGRSRVVLLDEPTSGLDPAARRALWDLLQREKRGRTVLLTTHFMDEADVLADRVAVLAAGRLACLGSPYFLKRHYGLGYKLALVKDAACQVDLVTEFFKTYVPNLKQNSNIGSELTYILPSESVSKFPEMLKKLEEKKESLCISSYGLSVTSLEEVFMKAGIEDNNVEIKETKGDIEMIDMNGDMLKDNEPLHKTQGFHLLKNHIKAMFLKLMYNTLRNKALAAIQIIWPIINIILSMIVSLSWKFLNVLPPLELSLESGFKGTETLVSQGNDLRDGSTEANVMMAYKDYFKRSTYPGLKLLDVGTSNLKNVYLKLIAEDQSRVRYEDLVGATFRNNSITAWFSNYGLHDSAISLSLVENAIIRSLSPNTTLTFVNHPLPYSVEGMVQVMSTGTNTAFMFSFSLGFCIAVISSFLVLFVIKERISGAKLLQRVSGVRPVVMWSTALIWDWIWLFLNHICIIVTIACFQEMGMSTPAELGRILLVLMVFSLAIIPLHYLASFCFEEAATGFSKMVFVNIFCGSMLFLVTEVLRMPFINAAAYAEILEYPFSLLPIYCVSKSVREMVTSSIKIKACDSLCNQLNYKNCTRLTICNELDISMCCIEDNPFLGWKEPGIARYLFTMIVVATVSFAILLAKEYELWNKVLYKKQEETMMLSGTKPKSNESKKVEVNAEVEDDDVVEEKQRVLAMTSSEVTAHSLVCRELSKRYRRLVAVDRLTFAVRGGECFGLLGVNGAGKTSTFRMLTGDARVSDGDALVHGHSVRAHVQDVHRLIGESTLLHLSSVRMLTGDARVSDGDALMHGHSVRAHVQDVHRLIGESTLLHLSSVRMLTGDARVSDGDALVHGHSVRAHVSVRMLTGDARVSDGDALVHGHSVRAHVQDVHRLIGESTLLHLSSVRMLTGDARVSDGDALMHGHSVRAHVQDVHRLIGESTLLHLSSVRMLTGDARVSDGDALVHGHSVRAHVSVRMLTGDARVSDGDALVYGHSVRAHVQDVYRLIGESTLLHLSSVRMLTGDARVSDGDALVHGHSVRAHVQDVHRLIGESTLLHLSSVRMLTGDARVSDGDALVHGHSVRAHVQDVHRLIGESTLLHLSSVRMLTGDARVSDGDALVHGHSVRAHVQDVHRLIGESTLLHLSSIRMLTGDARVSDGDALVHGHSVRAHVSVRMLTGDARVSDGDALVYGHSVRAHVQDVHRLIGESTLLHLSSVRMLTGDARVSDGDALVHGHSVRAHVQDVHRLIGESTLLHLSSVRMLTGDARVSDGDARVSDGDALVHGHSVRAHVQDVHRLIGESTLLHLSSVRMLTGDARVSDGDALVHGHSVRAHVQDVHRLIGESTLLHLSSVRMLTGDARVSDGDARVSDGDALVHGHSVRAHVSVRMLTGDARVSDGDALVYGHSVRAHVQDVHRLIGESTLLHLSSVHMLIADACVWDGDALMHGPLVRTHVQDVYCLICYCPQFDALFDNLTAREILKIFCLLRGIPTSIGETHAIHLAKQLGFIKHYDKKVRECSGGTKRKISTAVALLGDYPVIFLDEPTTGMDPASKRLVWRGISSAVGGGRSVVLTSHSMEECEALCSKLTVMVNGRLCCLGSLQHLKSKFSQGYTIIVKCKSGPNRDAAVLDVHNYMTTNFVGANLIETYLGMSTYHVSSAGLPWWRVFSALELARDSLPLDDYSVAQTTLEQVFLAFTKLQRPIN

Summary

Uniprot
ProteinModelPortal
PDB
5XJY     E-value=6.30508e-110,     Score=1023

Ontologies

Topology

Length:
2340
Number of predicted TMHs:
12
Exp number of AAs in TMHs:
266.667289999999
Exp number, first 60 AAs:
0.00299
Total prob of N-in:
0.31900
outside
1  -  221
TMhelix
222  -  244
inside
245  -  264
TMhelix
265  -  287
outside
288  -  310
TMhelix
311  -  333
inside
334  -  337
TMhelix
338  -  360
outside
361  -  369
TMhelix
370  -  392
inside
393  -  411
TMhelix
412  -  434
outside
435  -  864
TMhelix
865  -  887
inside
888  -  1040
TMhelix
1041  -  1063
outside
1064  -  1088
TMhelix
1089  -  1111
inside
1112  -  1123
TMhelix
1124  -  1146
outside
1147  -  1155
TMhelix
1156  -  1178
inside
1179  -  1255
TMhelix
1256  -  1278
outside
1279  -  2340
 
 

Population Genetic Test Statistics

Pi
191.593755
Theta
166.558713
Tajima's D
0.325655
CLR
0.3874
CSRT
0.458427078646068
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号