SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10320
Pre Gene Modal
BGIBMGA007221
Annotation
ATP-binding_cassette_sub-family_A_ABCA1_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 3.507
 

Sequence

CDS
ATGTCAGCTGTTGCAAAACTCAAACTTCTCATCTGGAAAAATGTTCTTCTCCAAAAAAGACACAAGTGGCAAACCATTTTTGAAATAGCATCACCAGTTATATTTTCTTTATTTTTAATATTAACAAGATGCCTCGTAGACCCAAAATCTAAACCTGCTATTACTTATTCACCATTTCAACCAACATATCTCAACATTACTGGTAGAAACCTAGGAAATTTAACAGCAGCTAAAACAGGAACACTTGCATTCTCTCCAGAAAACCCTTTAACAAGAAATGTTGTAAGGGATGCTATTGCAATGGTTGCAAATGACAACTTAAGTTTCCTTTTTACTTTTATATTTGACTCAAATATTCTACCTCAGCCTAAAGGATATAAGAATGCTAAAGATATGGAACTGGCACTTACACAACCCAATGCAATGAATCAAATTTTAGTTGGAATCCAATTTGATGATGTAATGGCCAATGCTACAGAATGGCCTGAAAACATAACTGTAAGATTTAGATTTCCAGCTGTAATGAGAACTCCGATGATTGAGCATCCACTGAGAGCTAGTTGGAGGACTAATTTACTCTTTCCATTGTTTCCAAGGCCAGGGCCAAGAGATGCAGACGATATGTATGGTGGAAAAACTCCTGGATATTCACCAGAAATGTTTTTAGCGGTACAGCATGCAGTGTCACAAGAAATAATCAAACAAAAAACTGGTAAAGCTATAAATACCAAAGTATACCTACAAAGATTTCCTCAGGTGGCATACAGAGAAGACGAATTGTTGATAGCTTTAGAGAGATTTATATCTATGATAATAATGCTTTGCTTTGCCTACACATTTGTGAACACCGTAAAAATGGTAACAAATGAAAAAGAATTACAACTCAAGGAAACTATGATAATAATGGGTCTACCCTCATGGCTCCATTGGCTTGCTTGGTTTATAAAACAATTCTCATTTCTTTTAATATCAGTACTTCTAATTGTGATCTTGCTAAAGATTCCTTTTAATCACACTGAAGATGGTCAAGGCTACTCTGTGCTCACATTTACACCTTGGTCTGTTCTATTTTTCTTTATGGTGCTTTACGTGATGGCATCACTTGCATTTTCTTTCATGATCAGCGTCTTTTTCAATAAAGCCAACACCGCCTCTTCGTTTATGGGTCTGGCGTGGTTTTCTACTTATGCCGTTTTCATGTTGACGCAAGTGCTGTACGAAGATATAAGTCTTACTACAAAATTACTTCTTAGTCTTATATCGAATACCGCCATGGGTTACGCCTTCCAGATGATTATAATGTGTGAAGGCACATCCAGAGGACTTCAATGGAACGAGTTTTTCTCTCCAATATCATATCACGACAAATTTCAACCGGGGCATGTTATGTTGATGTTGATGCTGGACACAATATTGTACATGTTAATTGCTATGTATGTCGAAAAAATACGACCGGGGAAATTCGGTGTACCGATGCCGTGGTATTTTCCATTCACGAAAAAATTTTGGTCGACAAATAAGTCGAGGATCGCTGCTGCAAAAACGGAAGAATCTAGCGATACAGCGTACCATGATGCTCTCCTGAAAGTTGTTCACGACGAAGAACCTAAAGATTCGCCCGTAGGTGTCGACATTCAAAATCTCACAAAGGTTTATAAAGGCAGAAAGGCGGCCGTTGATAATTTAACGTTAAGATTATATGAAAACGAAATCACCGTATTGCTCGGTCACAATGGGGCTGGCAAAACTACAACGATATCGATGTTAATCGGTATGATTCCTCCGACCTCCGGTACGGCTACGATAAGCGGCTACAATATAGTTACGGAAACTGAAATGGCACGTAGTTCTATAGGCATATGTCCGCAGCACAATGTCCTCTTCCCCGATCTTACTGTAGCGGAGCACATAGAATTTTACGCAAGATTAAAAGGAGTTTCGAACAATGAAATCCAGAAAGAGGTTGATCATTTCGTCAAACTTCTTGAGCTTGAGGAAAAAAGGCACGCGGCGGCGTCGAGTCTGTCTGGCGGGCAGAAGCGGCGGCTGTCGGCGGGCTGCGCGCTGTGCGGGCGCTCGCGCGTGGTGCTGCTGGACGAGCCCACGTCGGGCCTGGACCCGGCGGCGCGGCGCGCGCTGTGGGACCTGCTGCAGCGCGAGAAGCGCGGCCGCACCGTGCTGCTGACCACGCACTTCATGGACGAGGCGGACGTGCTGGCCGACCGCGTGGCCGTGCTCGCCGCCGGCCGCCTGGCCTGTCTGGGCTCCCCCTACTTCCTCAAGCGCCACTACGGACTCGGCTACAAGCTCGCGCTCGTCAAGGACGCCGCCTGCCAAGTCGATCTTGTTACAGAATTCTTCAAAACATACATCCCGGATATAAAGGAAAATACTAATATAGGATCGGAACTGACTTACATCCTACCTAACGAATATGTTAGTAAATTTCCCGACATGTTCAAAGATTTAGAAGAAAAAAGAGAATTGTTGAAAATATCTAGTTATGGTCTGTCATTGGCCAGCCTCGAAGAAGTGTTTATGAAAGCTGGTGCAGAATATAGTACAGAAAACGAGCCTAAAAGAAACCATCACAACATAGTTCCTTATAGCGATGATGCTATTGCGCCCATAGAATCTCAAAATTATAGTCATCTCGATTCTTCGGAGAAAGTCCGTGGTTTTAAACTTCTCAAAAATCATATAAAAGCAATGTTTTTGAAGTTAGCATACAACACTATGAGGAATAAACTGGTGGCTTTTATACAATTTGTGAGCCCCGTGATCAATATAATACTTTCTGTTATAATTTCGAGATCCTGGAAGTTCCTTTCGCAACTACCCCCACTAACGCTTCGTTTAGAGAGCGGATTTAAAACCACTCAAACTCTAATATCACAAATTCTTAATATAACAGAAGAGAGTATAGAAGCCAGAGCTCTGAAGGCCTATAAAAACTACTTTAAGCTCTCCACTTATCCTGGAATGACTTTGACGGACATTGGTACAATGGACATGGGAAAATTTTACTTCAAGCTGAGTGATTCCGATCTTCCTCGCGTAAAATACGAAACATTGGTCGGCGCTACATTTGGCCAAAACAAAATAACTGCTTGGTTCAGTAATTATGGATACCACGATTCTGCTATCTCGCTCGCACTTGTGAATGACGCCATACTGCGTGCCCTGTCGCCTGGAAGTTCCTTGAGAATCGTCAACTTTCCACTGCCGTATTCGATAGAAAACCTGGTTGAAGTAATGGCTACCGGTAGCAGCATGGGATTTCAATTCGCATTTAATATTGGATTCTGTATGGCTTTCGTGACTTCGTTTCTCGTCCTTTTTTCGGTTAAAGAGCGGCGTAGCGGGGCCAAGCTCTTGCAGCGCGTGTCGGGCGTGCGGCCGGCCGTCCTGTGGCTCAGTGCGCTTGTGTGGGACTGGCTGTGGCTGTTCCTCATCTACTTGTGTATTGTCTTTACTCTCGCTTGTTTCCACGAGAAGACGCTCTCCACGCCTCAGGAATTAGGGCGGGTGTTACTAGTTCTCGTAGTGTTTTCACTGGCAATAATACCAATACACTATCTGGCATCATTCTACTTTGACTCTGCTGCGACTGGATTTTCGAAAATGTGCTTCGTCAACGTATTCAGTGGTTGTATGCCGTTTTTAATTACTGAAGTATTAAGATTACCACAAGTCGCAAGTCCTTTTTATGCACATCTGTTTGATTGGATTTTTTCGCCGCTACCTATTTATTGTATCAGCCGGAGTTTCAGAGACATGAGTGTATCGTCATTTTCATTGTTGGCCTGCGAAGGCCTCTGCGACCAATTACGTATTGAGAATTGCACACGACACACAATATGCAACCAGCTCAACCTTACCGTGTGTTGTATTGAAGACGATCCTTTTATGAAATGGAGCGAACCTGGAATCGGAAGATACTTGTTTACTATGTTCGCTGTCGGTACAGTAACGTTCAGCATACTACTCGTGAAGGAATATGAACTTCTTGCCAAGCTCATGTACAAACCTCGTGATAAAATGTCGCAAACGAAAACCTCTGTAGAGGAGGCAGTCGAAGACGATGACGTCGCCACGGAGAGACGGCGCGTACTGGCATTGTCGCGTAATGAGGTCACCGCGTTCAGCCTCGTGTGTCGCGAGCTGAGCAAGCGCTACCGGCGCCTCGTAGCCGTCGACCGACTCACGTTCGCGGTGCGCGGCGGAGAGTGCTTCGGCCTGCTCGGAGTCAACGGCGCCGGCAAGACCAGCACCTTCCGCATGCTGACCGGCGACGCACGCGTGTCGGACGGCGACGCGCTCGTGCACGGACACTCGGTGCGAGCACATGTGCAGGACGTGCACCGCCTCATTGGTGAGTCGACCCTATTACATATCAGCTCGGTCCGCATGCTGACCGGCGACGCACTCGTGTCGGACGGCGACGCGCTCATGCACGGACACTCGGTGCGAGCACACGTGCAGGACGTGCACCGCCTCATTGGTGAGTCGACCCTATTACACATCAGCTCGGTCAATATGCTGACCGGCGACGCACGCGTGTCGGACGGCGACGCGCTCGTGCACGGACACTCGGTGCGAGCACACGTGCAGGACGTGCACCGCCTCATTGGTGAGTCGACCCTATTACATCAGCTCGGCCCGCATGCTGACTGGCGACGCACATGTGTCGGACGGAGACGCGCTCGTTCACGGACACTCGGTGCGAGCACACGTGCAGGACGTGCACCGCCTCATTGCTCGGCCCGCATGCTGACCGGCGACGCACATGTGTCGGACGGAGACGCGCTCGTGCACGGACACTCGGTGCGAGCACACGTGCAGGACGTGCACCGCCTCATTGGTGAGTCGACCCTATTACACATCAGCTCGGTCCATATGCTGACCGGCGACGCACGCGTGTCGGACGGCGACGCGCTCGTGCACGGACACTCGGTGCGAGCACACGAGCAGGACGTGCACCGCCTCATTGGTGAGTCGACCCTATTACATCATCTCGGCCCGCATGCTGACCGGCGACGCACATGTGTCGGACGGAGACGCGCTCGTGCACGGACACTCGGTGCGAGCACACGTGCAGGACGTGCACCGCCTCATTGCTCGGCCCGCATGCTGACCGGCGACGCACATGTGTCAGACGGAGACGCGCTCGTGCACGCACACTCGGTGCGAGCACACGTGCAGGATGTACACCGCCTTATTGGTTATTGCCCCCAGTTCGACGCATTATTCGATAACCTTACTGCGAGAGAGACCCTCCAGATCTTTTGTTTGTTACGCGGTATACCTCAGCGAGTTGGTGATGTACTTGCTCATCGTCTCGCTGTTGAACTGGGATTTGTCGTACACTACGATAAAAAGGTTCATGAGTGCAGCGGTGGAACAAAAAGAAAAATAAGTACTGCTGTAGCTTTGTTAAGCGCTTCGTCGTTAGTTTTCCTGGATGAACCAACAACAGGCATGGATCCTGCGTCGAAGCGGCTCGTGTGGCGCGGCATCAGCAGCGCGGTGGGCGGCGGGCGCAGCGTGGTGCTGACGTCACACAGCATGGAGGAGTGCGAGGCTCTCTGCTCCAAGCTCACCGTCATGGTCAACGGCAGGCTCTGCTGTCTCGGCTCGCTGCAACATCTCAAGAGCAAATTCTCGCAGGGCTATACGATTGTTATTAAATGTCGATCGGGAACTGACAGGGATAGCGATATCACACGCATCGACCAATATATGAAGAAAAATTTCAATGAAGTTAAACTCGTCGAGACGTACCTGGGCATGAGCACGTACCACGTGTCGTCGGCGGGGCTGCCGTGGTGGCGCGTGTTCAGTGCGCTCGAACTAGCGCGGGACTCGCTGCCGCTTGATGACTACTCGGTCGCGCAGACAACACTCGAGCAAGTTTTTCTCGCATTTACAAACCAACAGCGTTCACTAGATTAA
Protein
MSAVAKLKLLIWKNVLLQKRHKWQTIFEIASPVIFSLFLILTRCLVDPKSKPAITYSPFQPTYLNITGRNLGNLTAAKTGTLAFSPENPLTRNVVRDAIAMVANDNLSFLFTFIFDSNILPQPKGYKNAKDMELALTQPNAMNQILVGIQFDDVMANATEWPENITVRFRFPAVMRTPMIEHPLRASWRTNLLFPLFPRPGPRDADDMYGGKTPGYSPEMFLAVQHAVSQEIIKQKTGKAINTKVYLQRFPQVAYREDELLIALERFISMIIMLCFAYTFVNTVKMVTNEKELQLKETMIIMGLPSWLHWLAWFIKQFSFLLISVLLIVILLKIPFNHTEDGQGYSVLTFTPWSVLFFFMVLYVMASLAFSFMISVFFNKANTASSFMGLAWFSTYAVFMLTQVLYEDISLTTKLLLSLISNTAMGYAFQMIIMCEGTSRGLQWNEFFSPISYHDKFQPGHVMLMLMLDTILYMLIAMYVEKIRPGKFGVPMPWYFPFTKKFWSTNKSRIAAAKTEESSDTAYHDALLKVVHDEEPKDSPVGVDIQNLTKVYKGRKAAVDNLTLRLYENEITVLLGHNGAGKTTTISMLIGMIPPTSGTATISGYNIVTETEMARSSIGICPQHNVLFPDLTVAEHIEFYARLKGVSNNEIQKEVDHFVKLLELEEKRHAAASSLSGGQKRRLSAGCALCGRSRVVLLDEPTSGLDPAARRALWDLLQREKRGRTVLLTTHFMDEADVLADRVAVLAAGRLACLGSPYFLKRHYGLGYKLALVKDAACQVDLVTEFFKTYIPDIKENTNIGSELTYILPNEYVSKFPDMFKDLEEKRELLKISSYGLSLASLEEVFMKAGAEYSTENEPKRNHHNIVPYSDDAIAPIESQNYSHLDSSEKVRGFKLLKNHIKAMFLKLAYNTMRNKLVAFIQFVSPVINIILSVIISRSWKFLSQLPPLTLRLESGFKTTQTLISQILNITEESIEARALKAYKNYFKLSTYPGMTLTDIGTMDMGKFYFKLSDSDLPRVKYETLVGATFGQNKITAWFSNYGYHDSAISLALVNDAILRALSPGSSLRIVNFPLPYSIENLVEVMATGSSMGFQFAFNIGFCMAFVTSFLVLFSVKERRSGAKLLQRVSGVRPAVLWLSALVWDWLWLFLIYLCIVFTLACFHEKTLSTPQELGRVLLVLVVFSLAIIPIHYLASFYFDSAATGFSKMCFVNVFSGCMPFLITEVLRLPQVASPFYAHLFDWIFSPLPIYCISRSFRDMSVSSFSLLACEGLCDQLRIENCTRHTICNQLNLTVCCIEDDPFMKWSEPGIGRYLFTMFAVGTVTFSILLVKEYELLAKLMYKPRDKMSQTKTSVEEAVEDDDVATERRRVLALSRNEVTAFSLVCRELSKRYRRLVAVDRLTFAVRGGECFGLLGVNGAGKTSTFRMLTGDARVSDGDALVHGHSVRAHVQDVHRLIGESTLLHISSVRMLTGDALVSDGDALMHGHSVRAHVQDVHRLIGESTLLHISSVNMLTGDARVSDGDALVHGHSVRAHVQDVHRLIGESTLLHQLGPHADWRRTCVGRRRARSRTLGASTRAGRAPPHCSARMLTGDAHVSDGDALVHGHSVRAHVQDVHRLIGESTLLHISSVHMLTGDARVSDGDALVHGHSVRAHEQDVHRLIGESTLLHHLGPHADRRRTCVGRRRARARTLGASTRAGRAPPHCSARMLTGDAHVSDGDALVHAHSVRAHVQDVHRLIGYCPQFDALFDNLTARETLQIFCLLRGIPQRVGDVLAHRLAVELGFVVHYDKKVHECSGGTKRKISTAVALLSASSLVFLDEPTTGMDPASKRLVWRGISSAVGGGRSVVLTSHSMEECEALCSKLTVMVNGRLCCLGSLQHLKSKFSQGYTIVIKCRSGTDRDSDITRIDQYMKKNFNEVKLVETYLGMSTYHVSSAGLPWWRVFSALELARDSLPLDDYSVAQTTLEQVFLAFTNQQRSLD

Summary

EMBL
KP219766    ALE60401.1    KP219764    ALE60399.1    KP259910    ALF46271.1    + More
KQ459232    KPJ02763.1    KP219762    ALE60397.1    UFQS01000123    UFQT01000123    SSX00085.1    SSX20465.1    MG637361    AXZ96960.1    ATLV01024373    ATLV01024374    ATLV01024375    KE525351    KFB51284.1    ADMH02001563    ETN62056.1    UFQT01001165    SSX29213.1    GGFK01002043    MBW35364.1    SSX29212.1    GGFK01001892    MBW35213.1    KQ973114    KXZ75645.1    APCN01003267    DS232069    EDS33779.1    GEZM01043992    JAV78597.1    KXZ75646.1    GEZM01043991    JAV78598.1    EDS33778.1    CP012528    ALC48535.1    AAAB01008986    EAL38745.3    JXUM01020746    KQ560580    KXJ81818.1    CVRI01000061    CRL04041.1    AXCN02001694    CRL04042.1    CH477506    EAT39837.1    KFB51285.1    CH477911    EAT35115.1    JXUM01066793    KQ562416    KXJ75968.1    JXUM01020756    JXUM01020757    KXJ81821.1    NWSH01001098    PCG72614.1    EDS33777.1    GFDL01007896    JAV27149.1    AXCM01001782    AXCM01002518    GGFK01002440    MBW35761.1    ETN62057.1    AXCN02000888    KP219765    ALE60400.1    APCN01005871    AAAB01008960    EAL40064.3    KP219770    ALE60405.1    JRES01001244    KNC24298.1    EAA00188.4    JXUM01104202    JXUM01104203    JXUM01104204    JXUM01104205    KQ564867    KXJ71644.1    KP219767    ALE60402.1    EDO63868.1    ATLV01023213    KE525341    KFB48612.1    AGBW02011226    OWR47004.1    CH954180    EDV47604.2    EAT39838.1    GALX01004980    JAB63486.1    ALC48536.1    GBXI01012776    GBXI01008150    JAD01516.1    JAD06142.1    GBXI01007301    GBXI01005702    JAD06991.1    JAD08590.1    KP259912    ALF46273.1    JXJN01010498    JXJN01010499    KQS30569.1   
Pfam
PF00005   ABC_tran        + More
PF07776   zf-AD
PF17956   NAPRTase_C
PF17767   NAPRTase_N
Interpro
IPR027417   P-loop_NTPase        + More
IPR003439   ABC_transporter-like       
IPR026082   ABCA       
IPR003593   AAA+_ATPase       
IPR017871   ABC_transporter_CS       
IPR036259   MFS_trans_sf       
IPR012934   Znf_AD       
IPR013785   Aldolase_TIM       
IPR036068   Nicotinate_pribotase-like_C       
IPR013087   Znf_C2H2_type       
IPR041619   NAPRTase_C       
IPR040727   NAPRTase_N       
SUPFAM
SSF52540   SSF52540        + More
SSF103473   SSF103473       
SSF51690   SSF51690       
Gene 3D
PDB
5XJY     E-value=2.02381e-116,     Score=1079

Ontologies

Topology

Length:
1984
Number of predicted TMHs:
10
Exp number of AAs in TMHs:
275.206699999999
Exp number, first 60 AAs:
15.4459
Total prob of N-in:
0.11982
POSSIBLE N-term signal
sequence
outside
1  -  266
TMhelix
267  -  289
inside
290  -  309
TMhelix
310  -  332
outside
333  -  354
TMhelix
355  -  377
inside
378  -  383
TMhelix
384  -  406
outside
407  -  456
TMhelix
457  -  479
inside
480  -  916
TMhelix
917  -  936
outside
937  -  1091
TMhelix
1092  -  1114
inside
1115  -  1134
TMhelix
1135  -  1157
outside
1158  -  1176
TMhelix
1177  -  1199
inside
1200  -  1313
TMhelix
1314  -  1331
outside
1332  -  1984
 
 

Population Genetic Test Statistics

Pi
196.195677
Theta
165.250194
Tajima's D
0.106692
CLR
0.36659
CSRT
0.399530023498825
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号