SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10270
Annotation
PREDICTED:_uncharacterized_protein_LOC106141830_[Amyelois_transitella]
Location in the cell
Mitochondrial   Reliability : 2.673
 

Sequence

CDS
ATGGGGCTGGCATCACCCGTGCTAATAGAAGGGAAAGCGCTCATTCAGAGCATTTGGCGGAGCGGGATCGACTGGGACGACGTCATCCTGGAAAAGGACGAGGTGGCGTGGAAACGCTACATGGAGAACCTCCGCATGTTGCAAGGCCTCCGAATAGCAAGGTGCTTCTCGTGCTGCAGCACTGAGGGGGAGCTGCACACGTTCACCGACGCCAGCGAGAAGGCCTACGCGTGTGCAGTCTATTGGCGTCAGAAGACAGACGAGAGCACCTACCGCATCACGCTTCTAGCAGGGAAAGCCAGGGTGACCCCACTGAGACCAGTCTCCATCCCAAGGCTGGAGCTGCAAGCTGCGCTGCTGGGGACAAGGATGGCGCAGGCAATAGCGGACGAATTGGACATCGCAGTCGGTGTAAGGACGTACTGGACTGACTCCAGTACAGTCCTGACATGGATAAAGACCGACCCACGCACGTTCAAACCTTTCATCGCGCACCGACTCGCCGAGATAGAAGAGTCAACGAAGCCCCAAGAATGGCGATGGGTGCCTGGCTCGCAAAACCCAGCAGACGACGCAACTAGGGAGGCGCCGGCGGATTTCGACCACACGCATCGGTGGTTTAATGGACCCAAGTTCCTGACGTGGGATGGATCGCGCTGGCCCAAGCCGCGAACATTCAAGCAAGAACCGTCTGGAGAAAAGAAAGAGGCCTTCCTGGTCGCCACGGCGAGGACCGCTGACGCTCGACCCACGCCCGATCCGCACAGATTCTCAAGCTGGGTCAAGTTATTGAGAGCAACAGCCAGGGTCCTCCAATTTATCGAGCTGTGTCGACCTCGGAAGGAGAGCGCCTGCGTGTCCAGACAATTGGAGCAGCAAGATCCCACGTGGAGGACGACACGAACGAAGCAACCCCGATCCACATGGAAGTTAAGGACCCCGGAAGCACCTAAAGAAGCGTGGCTGCTGCTTGATCGAATCCACTTGAAGGAAGCGGAGAAGATCCTACTGAGAAGCAGCCAAGGAGAGAGCTTCGGTGAAAAAGATCCCGAACGTCACCCCAAGTTGCGACGGCTCGACGTCGTGATGGAAGATGGCCTGTTGCGCCTGCGCGGACGTATCGACGCAGCGCAATACATAGATGCAGGCTGCAAGCGACCGATCGTGCTGGACGGGAAGCACGTGATAGCGAGATTATTGATCAAACACTATCACGAGGCGTTCCAGCACGGTAACCACGCAACGGTGATAAACGAGGTGCGGCAGCGCTACTGGATCCTAGGTCTAAGATCGATCCTTCGAGCGACGGCCGTCCGATGCCAGTGGTGCAAGGTCTATCGGAGTACACCACGCCTACCGCCCACCGGAAACCTGCCGATAGAGCGGCTACGACATGGAGAGCCGCCGTTCACCTGTGCTGCCGTCGATTACTTCGGGCCCATGACGGTGACTGTAGGACGACGTCACGAGAAGAGGTGGGGCGTGCTGTTCACATGCCTCACCACGAGAGCAGTCCACATGGAGCTAGCAGCGTCACTGACGGCAGACTCAATGCTGTTAGCGCTGCGCAGGATGGCCGCCCGGCGAGGAACGCCCAAAGTCATTTACAGCGACAATGGGACTAACTTCGTCGGCGCCAACAAGGAGCTTAAGCAGGCAATCGAGAATGCAAGGGAAGCAGACGTCGTGTCACGGGCCGCTCAGATGAACATAAAATGGAAGTTCATCCCGCCAGGAGCGCCGAACATGGGAGGCGCGTGGGAACGTTTGGTGCGGTCCGTGAAGACCGCGCTGGCGGTCACACTGAAGGAAAGACACCCGAGGGAAGAAGTTCTGCACACTCTTCTGTTGGAGGCGGAGCACGTCGTCAACTCGCGACCGCTCGTCGCCAGGGAAGAGAGTTGGGAGTCAGAAGCACTCACGCCGAATCACTTCCTCATAGGGAGGTCCTGCGGAGCTCCAAGCATCGGCGACTACAGAGACGAAGACCTGACCGGCAAAAGGACATGGAGAGTGGCGCAGCGTATGGCGGACCACTTCTGGAGTAGGTGGGTCAAGGAATACCTGCCTACGCTGCTGCCCAGGAAGATCGACGGGAGAGCAGCTGGCGAGGACTTGCAGTGTGGGGATACCGTCCTCATAGTGGACTCCACGCTGCCACGCAACACATGGCCGCGCGGGCAAGTTGTCCACACCTACCCAGGCCCCGACAACCGTGTACGAACCGTCGACGTCAGAACGAGCGGCGGTCTGCTTAAGAGACCTGCCTCCAAGATGATCCTGCTGGTGCCTGCAACGAGCGACGAGCCCACGCCCATAGAGTCGCCACGACAAGGAGTCGGTGCTACGCACGAGGGGGAGGATGTTGGCGACAGCGGCGTCGCCCCATAA
Protein
MGLASPVLIEGKALIQSIWRSGIDWDDVILEKDEVAWKRYMENLRMLQGLRIARCFSCCSTEGELHTFTDASEKAYACAVYWRQKTDESTYRITLLAGKARVTPLRPVSIPRLELQAALLGTRMAQAIADELDIAVGVRTYWTDSSTVLTWIKTDPRTFKPFIAHRLAEIEESTKPQEWRWVPGSQNPADDATREAPADFDHTHRWFNGPKFLTWDGSRWPKPRTFKQEPSGEKKEAFLVATARTADARPTPDPHRFSSWVKLLRATARVLQFIELCRPRKESACVSRQLEQQDPTWRTTRTKQPRSTWKLRTPEAPKEAWLLLDRIHLKEAEKILLRSSQGESFGEKDPERHPKLRRLDVVMEDGLLRLRGRIDAAQYIDAGCKRPIVLDGKHVIARLLIKHYHEAFQHGNHATVINEVRQRYWILGLRSILRATAVRCQWCKVYRSTPRLPPTGNLPIERLRHGEPPFTCAAVDYFGPMTVTVGRRHEKRWGVLFTCLTTRAVHMELAASLTADSMLLALRRMAARRGTPKVIYSDNGTNFVGANKELKQAIENAREADVVSRAAQMNIKWKFIPPGAPNMGGAWERLVRSVKTALAVTLKERHPREEVLHTLLLEAEHVVNSRPLVAREESWESEALTPNHFLIGRSCGAPSIGDYRDEDLTGKRTWRVAQRMADHFWSRWVKEYLPTLLPRKIDGRAAGEDLQCGDTVLIVDSTLPRNTWPRGQVVHTYPGPDNRVRTVDVRTSGGLLKRPASKMILLVPATSDEPTPIESPRQGVGATHEGEDVGDSGVAP

Summary

EMBL
AF530470    AAQ09229.1    AB042119    BAA95570.1    AB042118    BAA95569.1    + More
KQ459986    KPJ18861.1    AAZX01023278    RSAL01000375    RVE42106.1    NWSH01008670    PCG62455.1    LNIX01000019    OXA44812.1    JXUM01009840    KQ560293    KXJ83223.1    LNIX01000003    OXA57597.1    LNIX01000039    OXA39294.1    LNIX01000007    OXA52015.1    OXA44855.1    JXUM01130316    KQ567562    KXJ69370.1    ODYU01003174    SOQ41584.1    LNIX01000004    OXA56250.1    JXUM01031097    KQ560909    KXJ80382.1    LNIX01000015    OXA46575.1    JXUM01083542    KQ563383    KXJ73941.1    GDHC01018323    JAQ00306.1    JXUM01127084    KQ567147    KXJ69602.1    GEZM01052586    JAV74401.1    JXUM01038372    KQ561162    KXJ79503.1    GGFL01001842    MBW66020.1    JXUM01136032    KQ568367    KXJ69026.1    GGFL01001682    MBW65860.1    JXUM01013493    KQ560378    KXJ82704.1    GAMC01017930    JAB88625.1    KL367508    KFD68106.1    KL367480    KFD71819.1    AJWK01027898    GGFJ01000333    MBW49474.1    JXUM01144298    KQ569759    KXJ68523.1    GEHC01000913    JAV46732.1    JXUM01111221    KQ565482    KXJ70922.1    GGFJ01000306    MBW49447.1    JXUM01016534    JXUM01056823    KQ561926    KQ560461    KXJ77135.1    KXJ82302.1    GAKP01020709    JAC38243.1    GAMC01020598    GAMC01020596    GAMC01020592    JAB85959.1    OXA56382.1    AAGJ04001285    AAGJ04095911    AAGJ04043389    GGFJ01001476    MBW50617.1    LSMT01000016    PFX33015.1    GGFJ01001462    MBW50603.1    GCES01096813    JAQ89509.1    AAGJ04091218    GDIP01036233    JAM67482.1    GDIP01004568    JAM99147.1    GCES01130050    JAQ56272.1    KL367650    KFD60758.1    GGFJ01000218    MBW49359.1    RSAL01000010    RVE53755.1    GCES01130483    JAQ55839.1    GDIQ01143107    JAL08619.1    AAGJ04173907    AAGJ04141734    AAGJ04146728    AAGJ04146729    GAMC01020594    JAB85961.1    GCES01095427    JAQ90895.1    GCES01111900    JAQ74422.1    GCES01095441    JAQ90881.1    GDIQ01002920    JAN91817.1    GGFK01006929    MBW40250.1    GDIQ01002921    JAN91816.1    GGFJ01000302    MBW49443.1    GCES01097166    JAQ89156.1    NSIT01000285    PJE78034.1    AAGJ04058558    KL367515    KFD67336.1    AAGJ04118726    KL367588    KFD62770.1    KFD71769.1    JXUM01151198    KQ571164    KXJ68235.1    JXUM01020939    KQ560586    KXJ81781.1    AAGJ04011441    AAGJ04008210    GCES01110894    JAQ75428.1    AAGJ04020014    HAEJ01014775    SBS55232.1    AAGJ04017771    JXUM01146045    JXUM01146046    KQ460970    KPJ10166.1    KL367507    KFD68223.1    GBYX01472248    GBYX01472237    GBYX01472235    GBYX01472234    JAO09406.1    JAO09417.1    JAO09419.1    JAO09420.1    AAGJ04135687    GBYX01453073    JAO28442.1    GGMR01020500    MBY33119.1    AAGJ04125735    RCHS01003537    RMX41025.1   
Pfam
PF03564   DUF1759        + More
PF05380   Peptidase_A17
PF00665   rve
PF18701   DUF5641
PF17921   Integrase_H2C2
PF05585   DUF1758
PF01565   FAD_binding_4
PF09129   Chol_subst-bind
PF00078   RVT_1
PF00628   PHD
PF06677   Auto_anti-p27
PF00069   Pkinase
PF10607   CLTH
Interpro
IPR040676   DUF5641        + More
IPR036397   RNaseH_sf       
IPR005312   DUF1759       
IPR001584   Integrase_cat-core       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR041588   Integrase_H2C2       
IPR008737   Peptidase_asp_put       
IPR001995   Peptidase_A2_cat       
IPR001878   Znf_CCHC       
IPR006094   Oxid_FAD_bind_N       
IPR016166   FAD-bd_PCMH       
IPR016164   FAD-linked_Oxase-like_C       
IPR016170   Cytok_DH_C_sf       
IPR015213   Cholesterol_OX_subst-bd       
IPR036318   FAD-bd_PCMH-like_sf       
IPR016169   FAD-bd_PCMH_sub2       
IPR016167   FAD-bd_PCMH_sub1       
IPR000477   RT_dom       
IPR011011   Znf_FYVE_PHD       
IPR013083   Znf_RING/FYVE/PHD       
IPR001965   Znf_PHD       
IPR019787   Znf_PHD-finger       
IPR019786   Zinc_finger_PHD-type_CS       
IPR001841   Znf_RING       
IPR021109   Peptidase_aspartic_dom_sf       
IPR009563   SSSCA1       
IPR036305   RGS_sf       
IPR000961   AGC-kinase_C       
IPR000719   Prot_kinase_dom       
IPR000239   GPCR_kinase       
IPR017441   Protein_kinase_ATP_BS       
IPR011009   Kinase-like_dom_sf       
IPR016137   RGS       
IPR006594   LisH       
IPR006595   CTLH_C       
IPR024964   CTLH/CRA       
IPR001969   Aspartic_peptidase_AS       
SUPFAM
SSF53098   SSF53098        + More
SSF56176   SSF56176       
SSF55103   SSF55103       
SSF57903   SSF57903       
SSF56112   SSF56112       
SSF48097   SSF48097       

Ontologies

Topology

Length:
796
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0063
Exp number, first 60 AAs:
0.00017
Total prob of N-in:
0.00003
outside
1  -  796
 
 

Population Genetic Test Statistics

Pi
242.466664
Theta
172.123023
Tajima's D
1.110453
CLR
0
CSRT
0.693315334233288
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号