SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10268
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.93
 

Sequence

CDS
ATGTACGAGCAATTGGAAACAAAAGAAGGTCAAAAATGTATATTTAAGCTCGCTAAACAGCGTTCCTGGAGCACGAGGGATTCCACTAGATGTCGGGCTGTTAAAGATCCAAGTGGTGAGCTACTGTATAAGGATAATTATGTACTATCAGCTTGGCATCAATATTATGAACAGCTACTGAGCCCTACTCAAGCTGCTATACAGGTAACAAACATTGGACTTATACCTCCAATACGACCCAATGAGGTCAAAATGGCGTTAGAAAAGTTGGCCAACAAGAAAGCCACGGGACCGGACGGTATTCCAGTGGAAGCTTGGAAGTGCCTTCGCGAGCACGGAATCGAAACGCTCACCAAACTTTTCAACTGTGTGTTGCGCTCTTCCAAAATGCCAGCGGCGTGGAGATTGAGCACCATAGTTCCTATTTATAAGGGGAAGGGCAGTGAGTACGAATGTAACAACTATCGCGGGATAAAGCTGTTAAGCCATACTATGAAACTGTATGAAAGAGTGATTGACAGCCGCCTAAGATCAGAGTGTTCACTATCCAAAAATCACTATGGTTTTGTACAGGGCTTATCTATCACCGACCCTATTTTTGCTCTAAATACGATCGCTGAGGAGTATCGTGCGAAACTTCGGCCATTGTATGTCGCATTCTTAGATATGGAAAAGGCATTTGACCGTGTGCCAAGAGATACGATCTGGTGGAGCCTTCGCAAGAAGAATGTACCCGAACATTATGTTAACGTCATAGTTGACATGTACAGGGATGCGAGGTCAATGGTACGGACAGTAGTGGGTCAGACAAAACCAATAGCAGTTGCAGAAGGTCTGCATCAAGGTTCAGTACTGAGTCCCTTTCTGTTCGGCATGGTTATAGACTCACTCACTGAGGTGGCGCAGTCCTCAGCCACGTGGACTTTCATCTATGCAGACGACGTTGCTATCTGCACCGAGAGCCGCACAGAGCTACGAGAGGCACTCCTGTTGTGGAAACAGCAGTTACAGGCCGGTGGTCTAATATTGAGTGTTGCGAAGACACATTACATGTCTTTTAATGACCCAGATCCAGGTGACAACAGTCCGATTTCCATTGACGGTCAACTTGTAAACATGTGCGATCAATACAAGAGGATGCCCGTTAAGCTCAAGGGTATGATCTATAAGACCATAATAAGGCCTGTTCTTATGTATGGCAGCGAAACATGGGCGGCAACCAAAAGGAACGTGCATACCATTCAAGTTGCTGAAATGAAGATGCTGAGGTGGATGTGCGGCGTGACTAGGCTCGATAAAATTCGCAACGAGTACGTGCGTGGAAGTCTAGGTGTACGGGACATCGCTGACAAGATGCAGGAGAGTAGGCTGAGATGGTATGGTCACGTGAAAAGGAAGCCGCCTGACTACGTCGGAAATTTGGCGCTACTGCTCGACCTCCCCGGTGGGAGACCTAGAGGTGGACCCAAGACAAGGTGGAGGGACGTAGTGCTGAAGGACAAGAGAGAATGCAATGTTGCTGACGAGGATGTCGAAGACAGAGCGAAGTGGAGGAGTAAAGTTAGGAAAGCTGACCCCACCACCATGTGGGATAAATAG
Protein
MYEQLETKEGQKCIFKLAKQRSWSTRDSTRCRAVKDPSGELLYKDNYVLSAWHQYYEQLLSPTQAAIQVTNIGLIPPIRPNEVKMALEKLANKKATGPDGIPVEAWKCLREHGIETLTKLFNCVLRSSKMPAAWRLSTIVPIYKGKGSEYECNNYRGIKLLSHTMKLYERVIDSRLRSECSLSKNHYGFVQGLSITDPIFALNTIAEEYRAKLRPLYVAFLDMEKAFDRVPRDTIWWSLRKKNVPEHYVNVIVDMYRDARSMVRTVVGQTKPIAVAEGLHQGSVLSPFLFGMVIDSLTEVAQSSATWTFIYADDVAICTESRTELREALLLWKQQLQAGGLILSVAKTHYMSFNDPDPGDNSPISIDGQLVNMCDQYKRMPVKLKGMIYKTIIRPVLMYGSETWAATKRNVHTIQVAEMKMLRWMCGVTRLDKIRNEYVRGSLGVRDIADKMQESRLRWYGHVKRKPPDYVGNLALLLDLPGGRPRGGPKTRWRDVVLKDKRECNVADEDVEDRAKWRSKVRKADPTTMWDK

Summary

Uniprot
Pfam
PF00078   RVT_1
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
SUPFAM
SSF56219   SSF56219       
Gene 3D
ProteinModelPortal
PDB
6AR3     E-value=4.18807e-05,     Score=113

Ontologies

Topology

Length:
532
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00928999999999998
Exp number, first 60 AAs:
0.0001
Total prob of N-in:
0.00225
outside
1  -  532
 
 

Population Genetic Test Statistics

Pi
60.641654
Theta
117.768561
Tajima's D
-0.592619
CLR
0
CSRT
0.216289185540723
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号