SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10251
Annotation
PREDICTED:_uncharacterized_protein_LOC105841690_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.627 Mitochondrial   Reliability : 1.005
 

Sequence

CDS
ATGGCCGTCAGAGTCATCCGCGGGTACCGCACGATTTCCTACGAGGCGGCTTGCGTCCTGGCCGGATCCCCGCCCTGGGACCTAGAGGCGAAAGTACTCGCGTCATTATATCGATGGCGCGAGGAAGAGCGGGCACGGGGCTCGAGGCTGGTGCAGCGGCAGATCGCGCTGCGCCGAGAGGAGCTCCGTCTGGCCTTGGTGGCGGAATGGCGGCAAAGGCTTCTGCGCCCTACCGCCGGCCTCGCAACCGTCGAGGCGATCCGGCCAGTACTCGACGACTGGCTCGGGAGAAGGCACGGATCCCTGTCGTTTAGGGTGACACAGGTGCTGTCGGGGCACGGTTGCTTCGGCAAGTACCTGTGCCGCATAGACAGGGAGCCGGACGCTCGGTGCCACCACTGCGTCCACTGCGGGGAGGACACGGCGCAACACACGCTCGCCGAGTGTGTAGCTTGGGAGGAGCAGCGCCGTGTCCTCACAAATGAAGTAGGAAGCGATCTGTCGCTGCCGGCCGTAGTGCGGAGGATGGTCGGCAGCGCAGAGTCGTGGGACGCGGTGGTGTCCTTCTGCGAGGACGTGATGTCGCAGAAGGAAACTGCAGAACGGGAGAGGGAGATCTCGACTCCCTTTCCCGGCCGCAGAAGGCGCACCGGGCGCAGGACAAGGGCGGACAATGCCCTTTTCCGCCCCCATGAATGGGTCCAGGGGCGAGGGACTTGGGAAAGCCCTCGCCCCCTATTCGATGGACCTGAGACGGAGGCGCATGCGGGTGTCGGCGCGTGCCTCTGA
Protein
MAVRVIRGYRTISYEAACVLAGSPPWDLEAKVLASLYRWREEERARGSRLVQRQIALRREELRLALVAEWRQRLLRPTAGLATVEAIRPVLDDWLGRRHGSLSFRVTQVLSGHGCFGKYLCRIDREPDARCHHCVHCGEDTAQHTLAECVAWEEQRRVLTNEVGSDLSLPAVVRRMVGSAESWDAVVSFCEDVMSQKETAEREREISTPFPGRRRRTGRRTRADNALFRPHEWVQGRGTWESPRPLFDGPETEAHAGVGACL

Summary

Cofactor
FAD
Similarity
Belongs to the GMC oxidoreductase family.
EMBL
KZ150386    PZC71062.1    KZ149950    PZC76665.1    AB126050    BAD86650.1    + More
AB090825    BAC57926.1    AB078935    BAC06462.1    AB078931    BAC06456.1    AB078930    BAC06454.1    KZ150308    PZC71477.1    AB078929    BAC06452.1    LBMM01009501    KMQ88083.1    ODYU01009945    SOQ54696.1    LBMM01012957    LBMM01012956    KMQ85900.1    KMQ85901.1    KZ149896    PZC78733.1    LBMM01012027    KMQ86470.1    LBMM01006538    KMQ90523.1    RSAL01000481    RVE41577.1    LBMM01003679    KMQ93242.1    LBMM01008861    KMQ88580.1    QOIP01000009    RLU18544.1    ODYU01005282    SOQ45985.1    D85594    BAA19776.1    LBMM01009494    KMQ88097.1    QOIP01000010    RLU18098.1    GL450953    EFN80213.1    QOIP01000031    RLU14697.1    QOIP01000007    RLU20280.1    LBMM01006725    KMQ90373.1    KQ460685    KPJ12887.1    LBMM01006110    KMQ90925.1    ABLF02006132    LBMM01005733    KMQ91252.1    LBMM01019839    KMQ83438.1    LBMM01019838    KMQ83439.1    LBMM01006662    KMQ90413.1    LBMM01004272    KMQ92618.1    LBMM01020326    KMQ83308.1    QOIP01000002    RLU25407.1    LBMM01006954    KMQ90166.1    LBMM01004697    KMQ92167.1    LBMM01014909    KMQ85000.1    LBMM01014294    KMQ85237.1    GGMR01011974    MBY24593.1    LBMM01011877    KMQ86578.1    LBMM01007088    KMQ90053.1    LBMM01006657    KMQ90417.1    LBMM01007162    KMQ89979.1    LBMM01007036    KMQ90099.1    LBMM01002052    KMQ95336.1    LBMM01008349    KMQ88951.1    LBMM01006671    KMQ90407.1    LBMM01002480    KMQ94776.1    LBMM01005216    KMQ91703.1    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF01553   Acyltransferase
PF07776   zf-AD
PF00096   zf-C2H2
PF00732   GMC_oxred_N
PF03372   Exo_endo_phos
PF17919   RT_RNaseH_2
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR036188   FAD/NAD-bd_sf       
IPR012132   GMC_OxRdtase       
IPR000172   GMC_OxRdtase_N       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR041577   RT_RNaseH_2       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF51905   SSF51905       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
262
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01068
Exp number, first 60 AAs:
0.00916
Total prob of N-in:
0.14972
outside
1  -  262
 
 

Population Genetic Test Statistics

Pi
52.296978
Theta
69.149678
Tajima's D
-0.875134
CLR
41.241366
CSRT
0.163441827908605
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号