SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10234
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.057
 

Sequence

CDS
ATGAGTGACGCCAATGGCGCGCTCTTTTTGAAGTTCGTCCGTGATTTTTGTCCGGACATCATCACGAGATTTGAAGCCTACAAGGCCGGCCTTGACGCGCCGGCATTCCGCGACTCTCCGTTGTCGCCCCCCGCGCCGGTACCTCGCGACTCGCCGATGTCGCCCCCCACCCCCGCGCCCGCGTCGATCGCGTCCTCCGTAGCGGCAAGCTCCGGCTCCGACTCCGAGTCGGAAATGGAGTACGAGTCCGCCGCGAGTCCCCAACCGGGAACCTCGGAAGGGTTCACCACCGTCGCGCGCGGGAAAAAACGCGCCCGCGCCGTGGAACCGTCCGCGGCGCCGAAACAACCGAAGGCCGCGAACGCGTCGCGGCCTAAAGTCGTGGTCTCACCCGACTCCCCTCGCCGCGCAACCCCGTCGCCGCGCCCCGGGCCCGCGCCCGTCCGAAAAGTTCCCGCGCCGCCGCCGGTCATCCTGCGGGAAAAATCTTCTTGGGATCGCGTATCCCTGGCCCTTAAGGCCAACAAGATAAATGTAGTCCATGCGAGGAATATTCCGCATGGAATACAAATCAAAGTAGAGTCATCCGACGACCATAGGTCTTTGACAGCATACCTCCGCAAGGAACGCATAGGGTATCATACCTATGCGCTCCAGGAGGAGCGTGAACTCCGCGTCGTAATACGCGGAGTCCCCAAAGAGCTCGACGTCGAGCAAATCAAGAATGACCTGGTAGGTCAGTCCTACCCCGTCATAAGTGTGCACCGGATGCACAGCGGGCGCGACAAATTCGCGTACGATATGGTGCTCGTAGCACTAGAAGCCACACCGGAGGGCAAGAAAATTGCCTCATGTCTCCGCACCGTGTGCGGCCTATCGGGGGTCACCGTAGAGGCCCCCTACAAACGCGGCACTCCCGGGCAGTGCCACCGTTGCCAGCTATATGGCCACTCCGCGCGTAACTGCAACGCGCGACCGCGTTGCGTGAAATGTTTAGACGATCACGCGACCACCGACTGCTCGCGCGTGAAGGAGACAGCGACGGAGCCGCCGAGCTGTGTACTCTGCCGCAAGCAGGGACACACGGCCAACTACCGTGGATGCCCCAAGGCTCCACGGAAGCGCCCGGCAAACGCGCCCCCTAAAACCGCTGGCCCAAAGACTTCGGCGCCCCGCGCGCCGAAACCGGCTTTCGTACCGGCTCCGGTGCCCACCGTCTCCGCGTGGGCGAAACCGTTGCCGTTCACGAAGGCAGGAACGACACCGGCACCCCAACCGCGGTACGCGCCGCAACCTCTACTCGCGCTGCGCCCCGCCCCCGCGCCCGCGCCCGGTCCCGCGCCTCGCCCCGGCCCCGCGCACTCAAACGACTTTACAATTATTCGCGACTACATCGCCGCGATAAACATCGACCGCATGCGTGCGTTCGCCGACGCCATGCGCAGAGCGGTCACGGCCGAAGACCGCCTAAACGCGACGTTCGAGTACATCGACGTCATCGAGTCCGTCCAGCGCACGCTGCGCGACCAGGTTTATGAGTTTCTACGTGACAATCTCATCGACATCCTTCTGGTGCAGGAGACCTTCCTAAAGCCCTCGCGTCGCGACCCCAAAGTCGCGAATTACGTCATGGTTAGGAATGACAGACTCTCCACCCGCAAGGGCGGTACTGTCATTTACTATAGGAGGGCCCTGCACTGCGTCCCTCTCGATACTCCCTCGCTCTTACATATCGAGGCGTCAGTGTGCCGCATCGCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTATATCTCCCTCCTGACAAACCCCTCCTGAGCAGTGACCTCGAGACACTACTCGGTATGGGGGACGCGGTCATTCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGCACGAATGTGAACGGTAGGCGTCTCGACGCGTTCATAGACGACCTCACATTCGAGATATTCAACCCCCCGACCCCCACGTGCTATCCGTACAACGCCGCGCGTCGTCCGAGCACAATAGATCTGGCACTGCTGAGGAACGTAACTCTGCGCTTGCGCTCCATCGAGGCAATGTCAGAACTCGACTCAGACCACCGACCTGTCGTCATGCAGCTCGGTCGCCCACTCAACCGCGAACCAGATACGAGGACCATGGTGGATTGGAAGAAGCTGGGCACGTGCCTAGCTGACACCGCTCCACCAATCCTCCCTTGCGGCCCGGATTCAACTCCATCCCCCGAGGACACCGTCGAATCCATAAACATCTTCACTGATCACGTCTCGACGGCGATCACAAGATCTTCAAAGCAAGTTGATGTAGAGGACTGCTTCCACCGCATCAGACTTTCCCCCGATCTTAGGGACCTCGTTGTGAGTTCCTTCTGCAGAGAGAATGCTATACGAGGTGGCTCACTGATCATTGTTAATAAAGATTATAAATGTAAGGAACGTAGAGACATTGTGAGCCTCTCTGTGGAACGGATTATTGAAATGGCCTGTGTAGAGCTTGAGCGATTCATTGTTGCAGAGTTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTCGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTTCCGAGGTCAAGGAGGCGATCGATAGCCTACAACCACGGAAAGCTCCCGGCTCCGACGGCATCCGCAACCGCGCGCTTAAACTGTTACCAGCCCAACTGATAACGATGTTGGCCACCATATTAAATGCTGCTATGACGAACTGCATCTTTCCCGCGGCGTGGAAAGAAGCGGACGTTATCGGCATACACAAGCCGGGCAAACCGAAGAACGAAACCGCGAGTTACCGCCCCATCAGTCTCCTCCCGGCGATAGGCAAACTATACGAACGGCTCCTTCGTAAACGCCTCTGGGACTTCGTATCCGCGAATAAAATTCTTATAGACGAGCAGTTTGGATTCCGCGCCAGACACTCATGCGTCCATCAAGTGCACCGCCTCACGGAGCACATCTTACTAGGGCTGAACAGGCGGAAACCCATTCCGACAGGAGCCCTCTTCTTCGATATAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTACTTGTCGAACCGTTCGTTCCGATATCGAGTCGAGGGAACGCGTTCCCGGCCCCGTCACGTCACAGCCGGAGTCCCGCAAGGCTCCGCCCTCTCCCCGTTACTATTTAGTTTGTATATCAACGATATACCCCGGTCTCCGGAGACCCATCTGGCGCTCTTCGCCGATGACACCGCCATCTACTACTCGTGTAGGAAGAAGGCGTTGCTTCATCGACGACTTCAGACCGCGGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATCAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACACCACGCTGAGCATCCCTCTCCCGACTAGGCGCGTCAATAACCCCGCCCCCGCCGTTCGCCCAATCACGATGTTCGACCAGCCCATACCGTGGGCCCCGAAGGTCAAATATTTAGGCGTCACCCTCGACAGTAGGATGACATTCCGCCCCCACATCAAGACGGTACGCGATCGTGCCGCCTTCATTCTAGGACGTCTCTACCCGATGATATGTAGGCGAAGTAAAATGTCCCTTAGAAATAAGGTGACACTCTACAAAACTTGCATACGCCCCGTCATGACCTATGCAAGTGTAGTGTTCGCTCACGCGGCCCGCACTCACTTAAAGTCATTCCAAATTATTCAATCCCGTTTTTGCAGGATAGCCGTCGGAGCCCCGTGGTTCGTCAGGAACGTCGACCTCCATGACGACCTGGACTTAGAGTCCATCAGTAAGTATCTGCAGTCGGCGTCCATGCGCCACTTCGATAAAGCGGCACGACACGAGAACCCTCTCATCGTGGCCGCCGGTAACTACATTCCCGATCCTGCGGACAGAATGGAAAGCAGTCGACGTCGCCCAAAACACGTCATCTCGGATCCGCCCGATCCACTAACGGTGCTTTTAGTTTTTAGTTTCGTGGGCAGCGGCTTGGCTGAGTCCCTGGCATCGCTGATGTCCAAGAGCAACGTTAACTACCATGAGGCAGATCGTATCACGTCTGCCAACAAAATCATTTAA
Protein
MSDANGALFLKFVRDFCPDIITRFEAYKAGLDAPAFRDSPLSPPAPVPRDSPMSPPTPAPASIASSVAASSGSDSESEMEYESAASPQPGTSEGFTTVARGKKRARAVEPSAAPKQPKAANASRPKVVVSPDSPRRATPSPRPGPAPVRKVPAPPPVILREKSSWDRVSLALKANKINVVHARNIPHGIQIKVESSDDHRSLTAYLRKERIGYHTYALQEERELRVVIRGVPKELDVEQIKNDLVGQSYPVISVHRMHSGRDKFAYDMVLVALEATPEGKKIASCLRTVCGLSGVTVEAPYKRGTPGQCHRCQLYGHSARNCNARPRCVKCLDDHATTDCSRVKETATEPPSCVLCRKQGHTANYRGCPKAPRKRPANAPPKTAGPKTSAPRAPKPAFVPAPVPTVSAWAKPLPFTKAGTTPAPQPRYAPQPLLALRPAPAPAPGPAPRPGPAHSNDFTIIRDYIAAINIDRMRAFADAMRRAVTAEDRLNATFEYIDVIESVQRTLRDQVYEFLRDNLIDILLVQETFLKPSRRDPKVANYVMVRNDRLSTRKGGTVIYYRRALHCVPLDTPSLLHIEASVCRIALTGHQPIVIASVYLPPDKPLLSSDLETLLGMGDAVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEIFNPPTPTCYPYNAARRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPLNREPDTRTMVDWKKLGTCLADTAPPILPCGPDSTPSPEDTVESINIFTDHVSTAITRSSKQVDVEDCFHRIRLSPDLRDLVVSSFCRENAIRGGSLIIVNKDYKCKERRDIVSLSVERIIEMACVELERFIVAELLADALQEQCTTSTQHADPEHTEFVDREVERRASLPPSDALPPITTSEVKEAIDSLQPRKAPGSDGIRNRALKLLPAQLITMLATILNAAMTNCIFPAAWKEADVIGIHKPGKPKNETASYRPISLLPAIGKLYERLLRKRLWDFVSANKILIDEQFGFRARHSCVHQVHRLTEHILLGLNRRKPIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDYLSNRSFRYRVEGTRSRPRHVTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTLSIPLPTRRVNNPAPAVRPITMFDQPIPWAPKVKYLGVTLDSRMTFRPHIKTVRDRAAFILGRLYPMICRRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHLKSFQIIQSRFCRIAVGAPWFVRNVDLHDDLDLESISKYLQSASMRHFDKAARHENPLIVAAGNYIPDPADRMESSRRRPKHVISDPPDPLTVLLVFSFVGSGLAESLASLMSKSNVNYHEADRITSANKII

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.000473018,     Score=108

Ontologies

GO

Topology

Length:
1421
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.37289
Exp number, first 60 AAs:
0.00016
Total prob of N-in:
0.00001
outside
1  -  1421
 
 

Population Genetic Test Statistics

Pi
1.865012
Theta
0.860089
Tajima's D
0.274817
CLR
113.057235
CSRT
0.529923503824809
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号