SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10204
Annotation
PREDICTED:_uncharacterized_protein_LOC101745010_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 2.46
 

Sequence

CDS
ATGTACTTGAGGATTTTAGTAAAGGACGAAGATAGGAAATTCCTGAGAATGTTGTATCGCTTTGATCCAAGCGAGGAGATAAAACTTTACGAATTCACACGTGTGCCATTCGGTTTGTGTTGTAGTCCGTTCCTTGCGATCAGGACTGTGCGCCAGTTAGTGACGGACGAGGGATCACAATTTCCTCTCGCGGCTCCAGTAGCTGACAGTGACGTTTTCACTGACGATTTGGCTACTTCCTGTGCGAATGAAGAAACAGCGGTCGAACTTTCTAATCAACTTATTAAAATGTTTCATGCTGGTGGTTTTGATTTGGTAAAGTTTTCAAGTAACTCACCAGAGGTTCTTTCTAAGATACCCTCTTCACATAGAGAATTCGAAGTTATAGAATTTAGTCCAGATAGCTATTTAAAAATACTGGGACTAAACTGGCTTCCAGCCGAAGACGTATTCACATTCACAGTAAATTTACGGAACCGCGAATGTACTAAAAGAAATATTTTATCAGTTATAGCAAGAATATGGGACTTAATGGGATTCGTAGCTCCTGTTACACTATGGGCCAAGCTCATCATTAAGTCACTATGGGCTAATAATATAGATTGGGATGAAACTCCTCGCCCTGAAATTGTAGCAGCTTGGCATCGATTCGTGTCTGAGTTGCCAATATTGGAAAATGTTAGAATACCACGACATACTGGCATTGTTATAGAGTGCATAGTTAGCTTATTGGGATTTGCTGATGCATCTGAAAAGGCCTATGGAGGTGTCGTTTATTTACATGTTTATTTTCCACAAACAAATAAGTTCACTATTACGCTTGTTTGTGCCAAATCCAGAGTAGCGCCGTTACGATGCGTGTCATTGGCAAGACTAGAATTATGCGGTAACTTGATTCTCGCAAAGTTGATGAGAGCAATTATTGACAGCTATTCTCATCGCTGTAAAATAAGTAATGTATTTGCCTTTACGGATAGCACCGTGGCTTTGGCATGGATTCACTCATCACCGGCTAGATGGCATACGTTTGTAGCCAACCGAGTAACAAAGATACAGGATGAAATACACCCCAGAAACTTTTATTTTGTATCGGGTAAAGAGAATCCAGCAGACTGTCTTTCACGCGGCTTAACACCATCACAATTGATGGAGCATCCTCTTTGGTTCAGTGGACCCCGATTTGCTCATCTACCCATTTCAGATTGGCCAGTTAAGAATTTTGATGCCACATCGATGACTGATATTCCAGAAATGAAACCAGCTATCATGCTATTCACAACTGATGATGCACGGAATGACAATATATTATACACGCTTGCATGTCGTATTTCATCATGGCCCAAGCTGGTCCGTATTGTACTTTATGTTCTCCGGTTTATTCAATTGGTACCGAGTAAATTTGATATTTCCCATTTAAAGGTGGCCGAAACGAATATCATCAAGGCTGTACAGCGAGTTCACTTTGATAAAGAACTTAAGAATGTGAAGTCTGGCAAAATATTACCGCCTGCATTTCAACGGCTCAGAGCCTTTGTTCACGAAGAAACGATAACGGAACATTCTAATCTCATCCAAAGGAAACGTATTGTAGACAGTTTGGTCCAGTCTTTTTGGAAAAGATGGAAACTTGAATATCTTAATACATTACAAGTTCGTAATAAATGGAAAAAAGATAGCACTCCTATTAAAACTGGCACAGTTGTACTGCTTCAATCTGAAAATAGTGCTCCTCTTAATTGGCCATTGGGTATAATAGAGGAAACTTTTCCGGGTCGTGATGGAGTTGTAAGGGTGGTTAACGTTAGAACGAAAACTGGTACTTATCGTAGACCTGTTGTTAAGGTTTATCCTTTACCAACACAGTAG
Protein
MYLRILVKDEDRKFLRMLYRFDPSEEIKLYEFTRVPFGLCCSPFLAIRTVRQLVTDEGSQFPLAAPVADSDVFTDDLATSCANEETAVELSNQLIKMFHAGGFDLVKFSSNSPEVLSKIPSSHREFEVIEFSPDSYLKILGLNWLPAEDVFTFTVNLRNRECTKRNILSVIARIWDLMGFVAPVTLWAKLIIKSLWANNIDWDETPRPEIVAAWHRFVSELPILENVRIPRHTGIVIECIVSLLGFADASEKAYGGVVYLHVYFPQTNKFTITLVCAKSRVAPLRCVSLARLELCGNLILAKLMRAIIDSYSHRCKISNVFAFTDSTVALAWIHSSPARWHTFVANRVTKIQDEIHPRNFYFVSGKENPADCLSRGLTPSQLMEHPLWFSGPRFAHLPISDWPVKNFDATSMTDIPEMKPAIMLFTTDDARNDNILYTLACRISSWPKLVRIVLYVLRFIQLVPSKFDISHLKVAETNIIKAVQRVHFDKELKNVKSGKILPPAFQRLRAFVHEETITEHSNLIQRKRIVDSLVQSFWKRWKLEYLNTLQVRNKWKKDSTPIKTGTVVLLQSENSAPLNWPLGIIEETFPGRDGVVRVVNVRTKTGTYRRPVVKVYPLPTQ

Summary

EMBL
GAIX01013989    JAA78571.1    GBHO01044644    JAF98959.1    GBHO01044645    JAF98958.1    + More
GBHO01044643    JAF98960.1    GBBI01004276    JAC14436.1    GEZM01054789    JAV73399.1    GEBQ01015458    JAT24519.1    GEBQ01000825    JAT39152.1    GEBQ01028569    JAT11408.1    ABLF02066034    GALX01004947    JAB63519.1    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    GEBQ01018232    JAT21745.1    GDHC01006469    JAQ12160.1    GEZM01054766    GEZM01054765    JAV73410.1    KQ971357    EFA07702.1    JAV73413.1    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    ABLF02017056    ABLF02035110    ABLF02067347    ABLF02030854    GEZM01085145    GEZM01085143    JAV60187.1    GALX01000776    JAB67690.1    GDHC01014057    JAQ04572.1    GBHO01039838    GBHO01006034    JAG03766.1    JAG37570.1    DS497760    EFA13221.1    GBHO01012499    GBHO01012498    GBHO01012497    GBHO01007479    GBHO01007451    GBHO01007450    JAG31105.1    JAG31106.1    JAG31107.1    JAG36125.1    JAG36153.1    JAG36154.1    GBHO01023090    JAG20514.1    ABLF02006304    ABLF02036268    GEBQ01005223    JAT34754.1    GBHO01028371    GBHO01028370    JAG15233.1    JAG15234.1    GDHC01016272    JAQ02357.1    LBMM01009403    KMQ88162.1    GBHO01004196    JAG39408.1    ABLF02025193    ABLF02030698    ABLF02030705    ABLF02030709    GDHC01002235    JAQ16394.1    GFTR01008866    JAW07560.1    LBMM01012238    KMQ86334.1    GBHO01044316    JAF99287.1    LBMM01009496    KMQ88090.1    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    LBMM01009551    KMQ88039.1    GBHO01007689    JAG35915.1    LBMM01016286    KMQ84479.1    GBHO01019177    GBHO01003185    JAG24427.1    JAG40419.1    LBMM01011283    KMQ86917.1    ABLF02035780    GBHO01029149    JAG14455.1    LBMM01009964    KMQ87756.1    GBHO01019080    JAG24524.1    LBMM01016285    KMQ84480.1    LBMM01011244    KMQ86944.1    ABLF02041863    ABLF02032595    ABLF02032597    LBMM01011245    KMQ86943.1    GDHC01021148    JAP97480.1    GGMR01017890    MBY30509.1    GGMS01010524    MBY79727.1    ABLF02005684    GGMR01000737    MBY13356.1    LNIX01000007    OXA51382.1    ABLF02039606    LBMM01009863    KMQ87831.1    LNIX01000044    OXA38660.1    LBMM01009202    KMQ88311.1   
Pfam
PF17921   Integrase_H2C2        + More
PF05380   Peptidase_A17
PF18701   DUF5641
PF00665   rve
PF05585   DUF1758
PF00078   RVT_1
PF03564   DUF1759
Interpro
IPR041588   Integrase_H2C2        + More
IPR012337   RNaseH-like_sf       
IPR008042   Retrotrans_Pao       
IPR001584   Integrase_cat-core       
IPR040676   DUF5641       
IPR036397   RNaseH_sf       
IPR008737   Peptidase_asp_put       
IPR000477   RT_dom       
IPR005312   DUF1759       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001878   Znf_CCHC       
IPR001969   Aspartic_peptidase_AS       
IPR036875   Znf_CCHC_sf       
IPR001995   Peptidase_A2_cat       
IPR000727   T_SNARE_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
621
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
3.09287
Exp number, first 60 AAs:
0.01399
Total prob of N-in:
0.13912
outside
1  -  621
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0.149647
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号