SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10203
Annotation
PREDICTED:_uncharacterized_protein_LOC105841331_[Bombyx_mori]
Location in the cell
Peroxisomal   Reliability : 0.974
 

Sequence

CDS
ATGTCTAAAGCCGAACAGGAATGTGAGGATTTTTATGATTTAAATACATACCGCGATAACACAACTGGACGTTACGTCACCGCTTTGCCTTTCTTGAGGTCGCCTACCGCTCTGGGCGATTCTCTTACAACCGCACGTCGCTGTCTGTCGTCACTCGAACGCAGATTTAAGACAAATATCGCTTTAAAAACTGAATACGATGCCGCGATGAGAGACTATCTCGAACGGAACATCATTTCACCCGCACCCGCTCTTACTGATACGAATTATTACGTCATCCCTCACCACGGTATAAGCCGAGAAGACAAACCGCTCCGCATTGTACTGAACGCAACTGCACGATGCATAGATACAAACGTTTCATTGAACGATTGTTTACATTCCGGTCCTAATTTGCAAGCAGACTTAACCGCGATTATTTTAAAATTCAGACTGTTTCCGATTGCTTTAACCGCCGACATCAAACAAATGTTTTTGGCTATAGGCATTCGTGAGGAAGACCGCCGCTTTTTGAATATACTATACAAATTTGACGAAGATGATACTGCGAAAATGTATCATTTTAATCGCGTTTGTTTTGGTCTACGGTGCTCGCCGTACCTTGCTATGAAGACAGTTAAGCGTCTCGCCCGCGATGAAACTGATTTCCCGATCGCTTCAGAAATCGCTAGTGATCATCTTTATATGGATGATCTAGGAGTTTCGGTAGATACGCCCGAGAATGGAATTCAGTTGGCTCATGATTTAATCGAACTATTCAAACGTGGTGGTTTCGACTTAGTTAAATTCGTTAGCAATTCGCCCGAGGTGTTAAAATCGATTCCGCAAGCCAACCGCTTATCTTCAAAAATTGAATTCGACAAGCAGGATAATATGAAGCTCCTAGGTATAATCTGGTCACCGGTCGAGGATGAATTTTCAATCGCTATTAAATTCAACCCGCAAGCAAAATGTACAAAGCGCCTTATGCTTTCCACAATCGCTAAACTGTGGGACATAAACGGATTTTGTGCCCCTGTCATTTTACACGCAAAATTGTTAATAAAAGCTCTCTGGGTAGCTCAGATTGATTGGGATGCAGAGCCCCCAAGCGACATCTGTGCTGCATGGAAACGCTTTCTTAATGAACTCCCCGCTCTGCAAGACTTTAAAATACCTCGCTTCGTAGGCATCGTGCCCGAGTCCCGTGTCATACTACTGGGATTTGCGGACGCTTCTGAAAAAGCGATGGGTGCTTCTGTGTACATTTGTGTACAACCGGCTTCCGGACCAAATGAAGTCAATTTAATTGGTGCCAAAAGCAAGGTCGCGCCGCTCAAGAAAACTCACCGCCTTTACAATGGACAATGGGCATAA
Protein
MSKAEQECEDFYDLNTYRDNTTGRYVTALPFLRSPTALGDSLTTARRCLSSLERRFKTNIALKTEYDAAMRDYLERNIISPAPALTDTNYYVIPHHGISREDKPLRIVLNATARCIDTNVSLNDCLHSGPNLQADLTAIILKFRLFPIALTADIKQMFLAIGIREEDRRFLNILYKFDEDDTAKMYHFNRVCFGLRCSPYLAMKTVKRLARDETDFPIASEIASDHLYMDDLGVSVDTPENGIQLAHDLIELFKRGGFDLVKFVSNSPEVLKSIPQANRLSSKIEFDKQDNMKLLGIIWSPVEDEFSIAIKFNPQAKCTKRLMLSTIAKLWDINGFCAPVILHAKLLIKALWVAQIDWDAEPPSDICAAWKRFLNELPALQDFKIPRFVGIVPESRVILLGFADASEKAMGASVYICVQPASGPNEVNLIGAKSKVAPLKKTHRLYNGQWA

Summary

EMBL
GBHO01005525    JAG38079.1    GBHO01044644    JAF98959.1    GBHO01044645    JAF98958.1    + More
GBBI01004276    JAC14436.1    GBHO01044643    JAF98960.1    GEZM01054789    JAV73399.1    GAIX01013989    JAA78571.1    LBMM01008464    KMQ88855.1    GEBQ01015458    JAT24519.1    GEBQ01000825    JAT39152.1    GEBQ01028569    JAT11408.1    GDHC01006469    JAQ12160.1    GALX01004947    JAB63519.1    GEZM01085145    GEZM01085143    JAV60187.1    GECZ01008071    JAS61698.1    LBMM01012188    KMQ86362.1    LBMM01010405    KMQ87487.1    ABLF02041863    LBMM01012238    KMQ86334.1    ABLF02008594    GBBI01004408    JAC14304.1    GBBI01004410    JAC14302.1    LBMM01010417    KMQ87475.1    ABLF02012239    ABLF02012241    ABLF02017372    ABLF02042178    ABLF02066436    GGMR01017890    MBY30509.1    ABLF02004035    ABLF02004036    ABLF02004037    ABLF02004038    ABLF02008018    ABLF02008020    ABLF02012635    ABLF02061171    ABLF02036131    ABLF02041527    ABLF02064049    GEBQ01004229    JAT35748.1    GBHO01037676    JAG05928.1    RSAL01001808    RVE40681.1    GDHC01019528    JAP99100.1    DS497760    EFA13222.1    GAMC01021577    GAMC01021573    JAB84982.1    GEZM01054766    GEZM01054765    JAV73410.1    JAV73413.1    GEZM01060254    JAV71154.1    LBMM01009202    KMQ88311.1    ABLF02066438    QOIP01000010    RLU17691.1    ABLF02025958    GALX01000776    JAB67690.1    GBHO01034255    GBHO01034254    JAG09349.1    JAG09350.1    LBMM01009496    KMQ88090.1    GEBQ01008079    JAT31898.1    GECZ01031358    JAS38411.1    GBHO01044316    JAF99287.1    GGMR01002421    MBY15040.1    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    ABLF02026240    ABLF02055027    ABLF02025690    GAMC01009674    JAB96881.1    GBHO01028371    GBHO01028370    JAG15233.1    JAG15234.1    LNIX01000036    OXA39969.1    GBHO01028449    JAG15155.1    LBMM01011245    KMQ86943.1    LBMM01011244    KMQ86944.1    ABLF02067195    ABLF02039606    GBHO01008418    GBHO01008416    JAG35186.1    JAG35188.1    GGFK01004613    MBW37934.1    GGMR01005823    MBY18442.1    GBHO01009080    JAG34524.1    GGFK01004538    MBW37859.1    GGMR01000737    MBY13356.1    GBHO01029149    JAG14455.1    GGMS01014133    MBY83336.1    GGMS01009443    MBY78646.1    ABLF02025193    GGFK01004563    MBW37884.1    GGMR01003456    MBY16075.1   
Pfam
PF05380   Peptidase_A17        + More
PF05585   DUF1758
PF18701   DUF5641
PF00665   rve
PF17921   Integrase_H2C2
PF03564   DUF1759
PF00078   RVT_1
PF03022   MRJP
Interpro
IPR008737   Peptidase_asp_put        + More
IPR008042   Retrotrans_Pao       
IPR036397   RNaseH_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR040676   DUF5641       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR041588   Integrase_H2C2       
IPR005312   DUF1759       
IPR000477   RT_dom       
IPR001878   Znf_CCHC       
IPR001995   Peptidase_A2_cat       
IPR036875   Znf_CCHC_sf       
IPR001969   Aspartic_peptidase_AS       
IPR017996   Royal_jelly/protein_yellow       
IPR011042   6-blade_b-propeller_TolB-like       
IPR029846   Yellow       
IPR000727   T_SNARE_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
451
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.12652
Exp number, first 60 AAs:
0.01465
Total prob of N-in:
0.01328
outside
1  -  451
 
 

Population Genetic Test Statistics

Pi
378.193075
Theta
190.335544
Tajima's D
3.206165
CLR
0.65813
CSRT
0.986000699965002
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号