SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10199
Annotation
PREDICTED:_uncharacterized_protein_LOC103311346_[Acyrthosiphon_pisum]
Location in the cell
Nuclear   Reliability : 1.042
 

Sequence

CDS
ATGGTCACAGTTGACGTACGCCCGGACGAGATCACACGTAATCCTACCTTCGAGTCTAGCACTGCAGCCTCCACTAATGCGTATGTGGGCTACAGTCGCTCGGTAGTTCTGTTGGGTACTTGTGTAGTTCGCGTTCGTCATCCTCGCAGTACTAATCAATCATTTCTTGTACGTGCGTTGATTGATAGTGGTGCTCAAGATTGTTTCATTACCAAGTCATGTTGTCAACGTTTGGGCTTACCATTACGTCGCTGTCCATTAACCGTAGTTGGTCTAGGTCAAAATGCTGTACATCACGTGACTGGAGTTACTTCTTGCACTGTACTTTCTCGTACTTTAGAAAATCCTCATTTCAACATTAATCCTATCGTAGTAAATACTATAACGAGTAAAATGCCTGCTACAAACTTACCTAGTAATCTTCGTGAATCTTTTAAACATCTGGTCCTCGCTGATGAGAATTTTGATAAACCATCAAATGTAGATTTACTACTTGGCGCAGAACTGTTCCATAGTATTTATGACGGTCAACGCATTCAGCCCAGTCATGATCTACCGGTAGCTTTACACAGCGTATTTGGTTGGGTCATCACCGGCAAACTTGATACAAACCATTTACCTCCGCCAACAATATCTTCTCTCTTAGCATCCACACGTTCTCTGGACGAGGGACTTAAGCGATTCTGGGAGATCGAAGAACCTCCAAATCAGGTTATCTTAAACCCTGAAGATATTAAATGTGAACAAATGTACTCAAATCTAACGTATCGTAATCCCGACGGCAGGTATGTTGTACCTATGCTTCTTAAAGAACCTATCAGTCAACTAGGCGATTCTTTCAACCAATCTTTCTCTCGGCTCGTTAACCTAGAACGACGCCTTGATCGAAACTTAGAGTTGAAAAAAGAGTACACCGCCTTTATGCGCGAATACAAGTTGTTAGGGCATATGGAGCCTAGCGCTGACTCGAATAAAATCGGGCAGTATATAATTCCTCATCATTGTGTCATTCGCCCGGAAAGTACAACGACTAAACTTAGGGTTGTATTCGATGCTAGCGCCAAAACTACCAATGGCAAATCTCTTAACGATCTTGTATATACTGGTCCAAAACTTCAAAACGATATAGGAGATATACTTACAAAATTTCGGTTGCATGCTGTTGTTTTTACTGCCGACATCAGTAAGATGTATCGAAACATCGAACTCAGGCCAGAGGACCGAAAATGGCAGCATATACTTTGGCGCGATTCTCCTTCTGATCCTGTAACTGAGTATGAGCTGAAAACGGTAACCTACGGGGTTACGAGTTCCCCTTATCTGGCAATACGTACTCTGCATCAATTAGCCTCTGACTACGAAAAAGAGTGGCCCTTAGCTGCTGCTAGTCTTCGTCATGATACTTTCATGGATGACATCACTGTTGGAGCTACATCTATTGAAACTGCACTGAAACATAAAGAAGAGTTAATACAAATGTTAGCGCGTGCTAAGTTCGAATTACGTAAATGGAGTAGCAACTCACCCGAATTCCTCACCCAGATACCAACTGAACATTGTCAAGTTCCAAAAACATTTTGTGATGAAAAACAAAAACAAAGTATCAAGATTCTTGGAGTCCAATGGGATCCAGCTGATGATAACTTCACTTATGCTTTATCAGAACTCACTCCAGGGAATACAAAACGTGCTATTCTATCAAACGTCGCCAGAATTTATGATCCACTCGGATGGTTAGCCCCAATGGTTCTAATAGCTAAACTTACCTTACAAGAACTATGGCGCCTTCAGCTTGACTGGGATGAAACTGTACCGTCAGATATGTTGTCTCAGTGGCATCTATTTACATCCGAGTTTCACTACCTGAAGGATATTAAAATTCCTCGACTAATTGTACCTCTTCATTCAAAATCATACGAACTTGTAGGTTTTTGTGATGGATCTACCAAGGCTTATGGTTGTTCTGTGTACTTACGTATCACTACCGACACTGAAATTACATCTCACTTGCTTATTGCAAAATCTAAAGTAGCTCCATTAAAAGTTCTTACTGTCAACCGATTGGAGCTATGTAGTGCTGTATTACTAGCAAAAATATTGAAGCATATTAGTAATTTACTAAATGCAACTCAAACCTCAAACATAACAATTTCAAAGATATGGGCATTCACTGATAGCTCAACTGTACTATCATGGCTGCAAACAGCACCTCATCGTCTTAAAACTTTCGTTGCACACCGTGTCGTGAAGCTGTTAGATAATTTGTCTGTCGAAAATTGGTATCACGTGTCAACGTATGATAATCCAGCAGATTACTGCAGTCGTGGTCTTACCTGCTCTCAGCTTGTGGCTTGTTCCACTTGGTGGACAGGACCCAAATGGATAGTCTCGAATTCTTCTACATGGCCGGTGTCTGAAAAATTACCTTATTTAAAGGAATTAGCCGAAAACTAG
Protein
MVTVDVRPDEITRNPTFESSTAASTNAYVGYSRSVVLLGTCVVRVRHPRSTNQSFLVRALIDSGAQDCFITKSCCQRLGLPLRRCPLTVVGLGQNAVHHVTGVTSCTVLSRTLENPHFNINPIVVNTITSKMPATNLPSNLRESFKHLVLADENFDKPSNVDLLLGAELFHSIYDGQRIQPSHDLPVALHSVFGWVITGKLDTNHLPPPTISSLLASTRSLDEGLKRFWEIEEPPNQVILNPEDIKCEQMYSNLTYRNPDGRYVVPMLLKEPISQLGDSFNQSFSRLVNLERRLDRNLELKKEYTAFMREYKLLGHMEPSADSNKIGQYIIPHHCVIRPESTTTKLRVVFDASAKTTNGKSLNDLVYTGPKLQNDIGDILTKFRLHAVVFTADISKMYRNIELRPEDRKWQHILWRDSPSDPVTEYELKTVTYGVTSSPYLAIRTLHQLASDYEKEWPLAAASLRHDTFMDDITVGATSIETALKHKEELIQMLARAKFELRKWSSNSPEFLTQIPTEHCQVPKTFCDEKQKQSIKILGVQWDPADDNFTYALSELTPGNTKRAILSNVARIYDPLGWLAPMVLIAKLTLQELWRLQLDWDETVPSDMLSQWHLFTSEFHYLKDIKIPRLIVPLHSKSYELVGFCDGSTKAYGCSVYLRITTDTEITSHLLIAKSKVAPLKVLTVNRLELCSAVLLAKILKHISNLLNATQTSNITISKIWAFTDSSTVLSWLQTAPHRLKTFVAHRVVKLLDNLSVENWYHVSTYDNPADYCSRGLTCSQLVACSTWWTGPKWIVSNSSTWPVSEKLPYLKELAEN

Summary

EMBL
GALX01004947    JAB63519.1    GFTR01008866    JAW07560.1    GGMR01017890    MBY30509.1    + More
ABLF02026240    ABLF02055027    GBHO01006408    JAG37196.1    GBHO01044316    JAF99287.1    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    GBRD01007977    JAG57844.1    GGMR01018294    MBY30913.1    ABLF02012239    ABLF02012241    ABLF02017372    ABLF02042178    ABLF02066436    GECZ01008071    JAS61698.1    LBMM01012238    KMQ86334.1    GBHO01038800    JAG04804.1    GBHO01038805    GBHO01038804    GBHO01038801    JAG04799.1    JAG04800.1    JAG04803.1    ABLF02066034    GBHO01039691    GBHO01039690    JAG03913.1    JAG03914.1    ABLF02030854    ABLF02067347    ABLF02008594    ABLF02041762    ABLF02025193    GBHO01000059    JAG43545.1    GEBQ01028569    JAT11408.1    GEBQ01015458    JAT24519.1    GGMR01006575    MBY19194.1    GEBQ01000825    JAT39152.1    GEBQ01015737    JAT24240.1    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    GDHC01018192    JAQ00437.1    GBHO01000060    JAG43544.1    ABLF02005684    GBHO01007689    JAG35915.1    GDHC01016272    JAQ02357.1    ABLF02008635    ABLF02023121    ABLF02065930    ABLF02065931    GBHO01000061    JAG43543.1    ABLF02004035    ABLF02004036    ABLF02004037    ABLF02004038    ABLF02008018    ABLF02008020    ABLF02012635    ABLF02061171    GEZM01054766    GEZM01054765    JAV73410.1    GBHO01039838    GBHO01006034    JAG03766.1    JAG37570.1    GEZM01085145    GEZM01085143    JAV60187.1    GGMR01016460    MBY29079.1    ABLF02003339    ABLF02058001    GAMC01006864    JAB99691.1    JAV73413.1    GGMR01003897    MBY16516.1    ABLF02041863    GBHO01030122    GBHO01030121    GBHO01030120    GBHO01030116    JAG13482.1    JAG13483.1    JAG13484.1    JAG13488.1    GDHC01014268    JAQ04361.1    GDHC01014057    JAQ04572.1    GBBI01004276    JAC14436.1    ABLF02008636    GBBI01004408    JAC14304.1    ABLF02039606    GBBI01004410    JAC14302.1    ABLF02035780    GBHO01034065    GBHO01034061    JAG09539.1    JAG09543.1    GGMS01012504    MBY81707.1    ABLF02015138    GDHC01002235    JAQ16394.1    GDHC01011948    JAQ06681.1    GBHO01037781    JAG05823.1    GGMR01005823    MBY18442.1    ABLF02041670    GGMR01014165    MBY26784.1    GDHC01019528    JAP99100.1    GGMR01002421    MBY15040.1    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    GGMR01003717    MBY16336.1    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    LBMM01009202    KMQ88311.1    GBHO01031928    GBHO01031926    JAG11676.1    JAG11678.1    ABLF02003736    ABLF02008292    ABLF02008294    ABLF02046909    ABLF02052378    GBHO01028617    JAG14987.1    GGMR01010723    MBY23342.1    GGMR01014351    MBY26970.1    GGMR01013370    MBY25989.1    GGMR01002024    MBY14643.1    GBHO01027036    GBHO01010996    GBHO01010995    GBHO01010993    GBHO01010991    JAG16568.1    JAG32608.1    JAG32609.1    JAG32611.1    JAG32613.1    GBHO01012499    GBHO01012498    GBHO01012497    GBHO01007479    GBHO01007451    GBHO01007450    JAG31105.1    JAG31106.1    JAG31107.1    JAG36125.1    JAG36153.1    JAG36154.1    GGMR01008932    GGMR01010920    MBY21551.1    MBY23539.1    ABLF02030698    ABLF02030705    ABLF02030709    GGMR01017784    MBY30403.1    ABLF02006784    ABLF02028666    ABLF02066713    GGMS01009443    MBY78646.1    ABLF02005251    ABLF02055296    ABLF02006304    ABLF02036268    GBHO01034255    GBHO01034254    JAG09349.1    JAG09350.1    ABLF02036131    ABLF02041527    ABLF02064049    GBHO01023090    JAG20514.1    ABLF02041650    GBHO01037676    JAG05928.1    GGMR01011131    MBY23750.1    GGMS01014951    MBY84154.1    GGMR01009860    MBY22479.1    GBHO01028371    GBHO01028370    JAG15233.1    JAG15234.1    GAMC01020552    JAB86003.1    GBHO01022454    JAG21150.1    GBHO01034062    JAG09542.1   
Pfam
PF18701   DUF5641        + More
PF05380   Peptidase_A17
PF03564   DUF1759
PF05585   DUF1758
PF17921   Integrase_H2C2
PF00665   rve
PF00078   RVT_1
Interpro
IPR001584   Integrase_cat-core        + More
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR008737   Peptidase_asp_put       
IPR040676   DUF5641       
IPR005312   DUF1759       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000477   RT_dom       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR001969   Aspartic_peptidase_AS       
IPR017907   Znf_RING_CS       
IPR001995   Peptidase_A2_cat       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF50630   SSF50630       
Gene 3D
PDB
4OL8     E-value=0.0329218,     Score=90

Ontologies

Topology

Length:
817
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0380400000000003
Exp number, first 60 AAs:
0.03239
Total prob of N-in:
0.00175
outside
1  -  817
 
 

Population Genetic Test Statistics

Pi
15.182063
Theta
27.946301
Tajima's D
-1.531574
CLR
251.772606
CSRT
0.0547472626368682
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号