SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10177
Pre Gene Modal
BGIBMGA005579
Annotation
PREDICTED:_Fanconi_anemia?_complementation_group_I_isoform_X1_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.53
 

Sequence

CDS
ATGGATTCAAGTTTTCTATTTACAAAATTAAAAGAATTAGGCCCAGTTAATAGTGAAAAGGATAACTTAATAGAGCATTGTACACAAAACATACAACAGATAATCAAGTTTTTGTCGAGACGTCTATTAGCTTCTGACGGAGGTCAAATTCTGGATTACCTTTTTAATGGTCTTACAGAAAGTTTAAAGATACACAAAATAAAGATAGTAGATGTTATACTACAAACAATGAGAAAGGAGCCCTCATCATTGACTCATTGTGCAGATATCATCAGTAGACTATGCTTGGAACTTCCACAGTTACCTGCCAATGATTTAGTTAGGTGGTGCAATGATAGCATACAGTCTGTTGTTGAAGATACTGATGTTAACATGATTTGGCGTGACATTGTACCGGAGTGCATTAGCTCTCTACAAAACTATGATAGCATACAACATTATGATACAGAGATGAGCAGTGATGACTACAAAACTCAGTGTGTACACACCTTATGTCAGTTTCAGTGGAAGGAAGAGCATTTGGTTCAACTTGCTGCAATGTTTACAGACATGCAGTTGTCACGAGTTGATCACACACAAGTAGTGAACAAAATGTGTTCGTTAATAATCAAAGTTGCACCAGAAAACTTGCCCCCTCTTACTTTGCAACTTATGCGGTTGTGCAAGTTATATAATTTAGATATAGTATTATCACATTTGAGTCATTACTTTAATGCAAGTTTATTTGGCAAATTGGAACCCCCTCCACAAGATTCAGAGTCAACAACTATGGATGTTGACGATATTGTTTCTTACACCATAGCAGAATTCAGTCAATGTCTGTCAAATTGTATATTTCATATATCGCAAGGGCCTGTAGACCCGGAGCTTGTGCGAAAACATCTAAAAATGTGGCCCAAAACTCAGCTGTTGAGGTCCCCTTTCATGGTGAATTTAGCTTTGGTTATGTCAGACAAGGGAACCGATTATAGAACTGTTTGTTTGAATGTGATAAAGTCGGCGATAGAACAGCGTGTATTGGACGATATAATGCGCAAGAAATCAGCTTGGGAGCGGTCGGTAATGCCGCCTGATGTGGACGTCGCCAGCCTGCTCAAAGTACTCACTGCGGACAGAGTTTTTGAATCTAAACCAATTGAGGACTTGCCACACGACCAACCCCTGGATAGGCCAGTACACCCTAAAAGGGTAAGGGTACTCCCTCCTGTCGCGGTGACTAAAAACCCAAGATCAGAAACATGCTCATCACCGGAAATTACCCCGTTGTCCTCCCGCGAAGCAGAAAGAATGGAGGTCGGCGGCATCGTGCCATCGCATGCCCTAATGCCTTCGTCCAGTAACAGCCCAGTTCCTGATGACGAAATCAACGCCTCACTAATTAATTATGGCAGCGAGACAGAGTCTGACGAAGAGGAAGTAGGAATTGGCCAGTCGTTAGTGGTGCCCCGGGTGGTTAGGATGTTGATGGACGAAGATGAGGAAGATGAAGAAAATGGCCTCAACGTTTCTTTGGAGTGGCCTACTCAATCATCCATTTGTACCTCAAAACCCGCCTCACCGATGCTTCCTACACCGACGCCTGTTTCACCGACTCCCATGGAGCCTAGTAACAAATTTAAATTTGTATGGAGAGCGGTTTCAATGCCTCAAATTGAACCTCATTTGAGGCGAGAACCATTCTCGCAAATTAATAGTGGCCCTACGGTTTCTTTTGCGAGTCCCTATGAAGCATTTATTGCCATATGGGATCGTGAAATTATGGAAGTTATTGTGAGGGAAACCAACATTTATGCACAGAAGCTTGCAACGGCCATGTTGGAGAATGGGACCATCTATCCTATTAGCCGGATTACGCATTGGCAAGATACGAACGTAAACGAACTTTACACGTATTTTGCCATTGTTCTGGCTATGGGTAAGGTGGTCAAAAGCCGCTTAGAGGAGTACTGGTCCACCTCTCAAGACATATTTAGTACTCCCTGCTTCTCCACGGAAATGACACATGACCGTTTCCTGCTTCTGTCGAAATGCCTACATTTTAATAGTAATAATTATTGTGACCCTGCATTGTTGACACAACACCAGATTAAACTTTTAAAAATAAAACCATTAATAGACCACCTTAATAATAAATTTTCAGAACTATATAATTTATCTCAAAATCTGGTTATTGATGAGAGCTTGACAACGTGGAAGGGCTGGCTTGATATAAACCAGTCATTCCCTAATGAGGCAGCGACAGCTGAGATCAAAGCTTATGAATTGTGTGAATCACAAAGTGGTTACTTGTGGCGGTTTGAATTACACGCAGGCCTTGACACCTCGACACCACAAGATAATCCAATTTCTGGGACAGTACCAGCTCTCGTGCTCAGACTTTTAGATGGTCTTGAGCACAAAGGGCATACAATATGGATGGACAGTTTCTTCAACTCTCCAGCACTAGCACGAGAACTGAAGGTCCGGGGATTTGACTGTGTGGGTACGCTGCGAACAAACCGTCAATTTGTGCCATACGATTTGACGCGTCTTACAATAAAGGATCTGACAGTCGGCCAAGTATTGGGATGCACCTCGGGAGATGTGGATCTTATGGTCTGGAGGGATAGAAAACGGGCGGCGTTTATTTCCACATATCATGGTTTGGCATCTACCAGGTTCAGGGAAAAACTGAAGCCGACTGTCGTGCATGACTATAGTCTCTGTATGGACAGATTAGATCGCAGGGACCGGCTGCTCGCAACGTTCCCCATAGAAAGACGGACTAAAGCTTGGAGCAAGAAATTTTTTAGAAGGCTCTTGAACATTAGTGTCCTGAACTCGTACATCTTACTCCAGAATCAGTCGTTGCTACACCGGAATTTCCGGAATGCGTTGGTAACTGATTTGCTGACAGCACACAGAACACCTAAACCTAACACAACAACAATCGCAACACAAGTACATTACCCGGCGCAGTACCCTTTGATCAAGCGCGGAAATGCCAGCCAGTTGTCGGTCGGATTAATGAACTTAGCGTTTGCACTTCTGTCGGTGTCTCCTATAAAGCCGGTAGCTCACGCGTGCTGGTCACACGGGAAGCTTATATTGGTGCGGCTGTGCAAAGCGCAAAGGGAGACGGTTCCGTATGTACTGAACAACTTGGGGGACAGGCTGGCGGGACATAACGCTCAGAAACAATATGCAGATTGTCTGTACGTGCTGTGCAAGCTAACGCCGGCGTCCGTGGAGGGTCGCTCGGAGCTGAGCACGATATTAGAGAACTGTCAGCCCTCCGGTGGCGACTACGGACTGAGCGCGGCCGTTCTCGATTCAGTACGCCCTCTCATCAACTTCAGTACCAGAACCAGGGATACCTTGGTCATGGTGTGCCGCAAGGGATTGTATTCAAGGGATTCGTGTCATCGTTGTCTGGCCCTGTCCGGTTTCCTGACCGTGCTGCGTCACGTCCGCCTATCGCGCGCCCTGTCCAGCAGCCAGGCCGAGAGCAGTGAGCAGTACAGCGCTAACTCCTATCTCACTCAGATCGCCGTCGACTTCCACGCCTCGCAGCAGGGCACGGCAGTAAGTTCAAGAGTGCGCAATGAAGCAGTCTGTATGGAGGTCGTGTCGATACTACGCAGGTGTCTTATGCAAGATGCCCTTGTCAAAGAATTGCTTTATACAAAGATCTACGATTGCTCTCAAGAAAAAATCGCCCTCCACGAATTGATAATGGAATTACTGTACGAACATCTAAGTAAATATTTAACGGATAACAACTCTTTGATGTTGGATAAGTGCGTTCAAATTGGCGCTACAAACGCAACGCTACTTGAACCAATATCCAATCTCCTGTACGTCATATGTCAGTTCCTTCAGCCAGAACTGGAGGAAGACTACGAGGACATCCTCGCCAGTAACACGGAATCCGGTAGCACGTTTTTGAAGAACAAACTAAATCTAATCATGGAGGGGCTGTGTGCCAGCAACGACTTGGGGCAGATATGCGTGGAAGATCCAGGTCTCTCCGACTTAACGCCCGAATCGAAGGCCAAATGTTTGAAAGTACAACAGACGCTCCAGATATACGAAACTCTGATCGCTTATCAAATAATGCAATGGAGACCGGACAGCACTGAAGCCGCGGGTACTGTGTACAGGCTCTACAAAGAGTGTGACCAGTTGCTGGAGAAAACTAAGGGACCATCAAAGTTAGCGAAAAAGCGCAGGAAATCCTTAAACGAAACGAAAGATTCGACGGTTAAAAGTCAAAAGTCTCCTAAAAGTCAGAAAGGCAAATCAAAGAGCCCCAAGAAACTTTCGAATATGGTCAAAGACAGAGGAAGCGCTTTCAAACAGCTGCCGTGTCTGTGGGACTTGAAGCTCTGCGTTAGGATCGCAGGATTACTCTATGCTGAGCACGTTCCCTGGACTTCGTCGGATCAACGCAACCAACTTCGTGCCCGAAGGGACTTCCACGTGTGGACGTTACGATGTATCGTTTCGGTCCTATCCAAAAACAATTTGGAGAAACACCACGTGGCCACGCACGTTGTCAGTTTGTGCCGGCTCATGTACAGCAGGTGTATTTGTAGGTTCAGCGAGATGTGTGAATTCGACGATCAAACCACCGTAAACTGTATCGAGGTCTTCAGGCTGTGTCTAAGCTTGCTGTTCTCCAACAATTATTCCTTTAAATTGGATTTCTTTCTTCCGAAGATCACTGACCAAACGGAGACTGTGCCGTCTGCGTGCATGGCCCTTATATTAGAGAAAATACTTGCTTCTTTGACGTTAATGGAGGAGGAAGCCTTCGCAGAAGGAAACGAGTCTAAGAAACTGATAATTGGTCTCGTGAACACAGCCAGCCTGCTGCTGGAGCAACCAGTACAGTCTACACCGGAGATGACAAGTGTTATAGTAAAGTTCGAAGACTTCATGCGGAAAACGTATCATGATTGCTTGTCGATGCTGCCCGCGCTACTGGCGGCCGGCTGTCGGGAACACCAGGAGACGCTGTTCTTGGAAGACTTGCTGGCGAAACTCACCGAATCTCTCGGTAAGATTGATGAAGAAGACACATCAAGGAACGAATCGTGCACGCTGTTCGGTTCAGTGACCGACGTCACAGTGCATTCGGTCCTGAACTATTTGTGCGTTCACTTGAGTGACAGGATGCAGTGCGCGGAGCACTTGCTGCACAGAGCCCGCGACCTGAGCGCCGCAGTGCCGCGCGCCACGCCCACCGCCCGACTGAGGATCGAGAGAGAACTCAATGAAATTTACGAATCTACAGTGGTACATATGTGCCAGTTGACGACGTGGACTTCGAGGGTGGTCTCGTTACGTTGTTCCGTGGGTCCGAGCAGCAGTCGCGTGCTCGGCACGTGCACGCGGCTCTATACGTTACTGGCAACACTGGCCAAGCAAATCAGTGTTGCCATAGCAAAGAATGCGCGTTTCGATCGCCTCCTGAAACTGAGCGGCAAGCGACTATCGACAATCAAGGACAATTTCATCACGTACCTGGGCTCGTCGCAGGAGCTCGTCTCGGCTCGGCGGGTGGAGCGCGACACCAAGCTGATACCGCGCCTGGTGCACGAGGCCGAGCAATACGCCAAGCACGTCATACTGCTGGCCGATAAGGCGCAGTTGAACTGGCAACAATATCTGTCGTTGGGAACGTCGCGCGACTTCAGGATCAACGGGCAGATCCTGCAGCAGGTGCTCCACGACGCCGACGGAGACGACGCCGACCGAACTAACGAGGACATCCACGACGCTAGTACTGTGGTTACGCAAGAAGATTCCGGAGACGAAGATAATCAAGAGGAATTAGAAGAAGAGGGAGAACCTGAGAACAGTGATGAAGGAACCCCTGAGAAGAAAAGGAAACGAATATAA
Protein
MDSSFLFTKLKELGPVNSEKDNLIEHCTQNIQQIIKFLSRRLLASDGGQILDYLFNGLTESLKIHKIKIVDVILQTMRKEPSSLTHCADIISRLCLELPQLPANDLVRWCNDSIQSVVEDTDVNMIWRDIVPECISSLQNYDSIQHYDTEMSSDDYKTQCVHTLCQFQWKEEHLVQLAAMFTDMQLSRVDHTQVVNKMCSLIIKVAPENLPPLTLQLMRLCKLYNLDIVLSHLSHYFNASLFGKLEPPPQDSESTTMDVDDIVSYTIAEFSQCLSNCIFHISQGPVDPELVRKHLKMWPKTQLLRSPFMVNLALVMSDKGTDYRTVCLNVIKSAIEQRVLDDIMRKKSAWERSVMPPDVDVASLLKVLTADRVFESKPIEDLPHDQPLDRPVHPKRVRVLPPVAVTKNPRSETCSSPEITPLSSREAERMEVGGIVPSHALMPSSSNSPVPDDEINASLINYGSETESDEEEVGIGQSLVVPRVVRMLMDEDEEDEENGLNVSLEWPTQSSICTSKPASPMLPTPTPVSPTPMEPSNKFKFVWRAVSMPQIEPHLRREPFSQINSGPTVSFASPYEAFIAIWDREIMEVIVRETNIYAQKLATAMLENGTIYPISRITHWQDTNVNELYTYFAIVLAMGKVVKSRLEEYWSTSQDIFSTPCFSTEMTHDRFLLLSKCLHFNSNNYCDPALLTQHQIKLLKIKPLIDHLNNKFSELYNLSQNLVIDESLTTWKGWLDINQSFPNEAATAEIKAYELCESQSGYLWRFELHAGLDTSTPQDNPISGTVPALVLRLLDGLEHKGHTIWMDSFFNSPALARELKVRGFDCVGTLRTNRQFVPYDLTRLTIKDLTVGQVLGCTSGDVDLMVWRDRKRAAFISTYHGLASTRFREKLKPTVVHDYSLCMDRLDRRDRLLATFPIERRTKAWSKKFFRRLLNISVLNSYILLQNQSLLHRNFRNALVTDLLTAHRTPKPNTTTIATQVHYPAQYPLIKRGNASQLSVGLMNLAFALLSVSPIKPVAHACWSHGKLILVRLCKAQRETVPYVLNNLGDRLAGHNAQKQYADCLYVLCKLTPASVEGRSELSTILENCQPSGGDYGLSAAVLDSVRPLINFSTRTRDTLVMVCRKGLYSRDSCHRCLALSGFLTVLRHVRLSRALSSSQAESSEQYSANSYLTQIAVDFHASQQGTAVSSRVRNEAVCMEVVSILRRCLMQDALVKELLYTKIYDCSQEKIALHELIMELLYEHLSKYLTDNNSLMLDKCVQIGATNATLLEPISNLLYVICQFLQPELEEDYEDILASNTESGSTFLKNKLNLIMEGLCASNDLGQICVEDPGLSDLTPESKAKCLKVQQTLQIYETLIAYQIMQWRPDSTEAAGTVYRLYKECDQLLEKTKGPSKLAKKRRKSLNETKDSTVKSQKSPKSQKGKSKSPKKLSNMVKDRGSAFKQLPCLWDLKLCVRIAGLLYAEHVPWTSSDQRNQLRARRDFHVWTLRCIVSVLSKNNLEKHHVATHVVSLCRLMYSRCICRFSEMCEFDDQTTVNCIEVFRLCLSLLFSNNYSFKLDFFLPKITDQTETVPSACMALILEKILASLTLMEEEAFAEGNESKKLIIGLVNTASLLLEQPVQSTPEMTSVIVKFEDFMRKTYHDCLSMLPALLAAGCREHQETLFLEDLLAKLTESLGKIDEEDTSRNESCTLFGSVTDVTVHSVLNYLCVHLSDRMQCAEHLLHRARDLSAAVPRATPTARLRIERELNEIYESTVVHMCQLTTWTSRVVSLRCSVGPSSSRVLGTCTRLYTLLATLAKQISVAIAKNARFDRLLKLSGKRLSTIKDNFITYLGSSQELVSARRVERDTKLIPRLVHEAEQYAKHVILLADKAQLNWQQYLSLGTSRDFRINGQILQQVLHDADGDDADRTNEDIHDASTVVTQEDSGDEDNQEELEEEGEPENSDEGTPEKKRKRI

Summary

Uniprot
ProteinModelPortal
PDB
3S51     E-value=2.53778e-12,     Score=181

Ontologies

GO

Topology

Length:
1961
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01534
Exp number, first 60 AAs:
0.0003
Total prob of N-in:
0.00003
outside
1  -  1961
 
 

Population Genetic Test Statistics

Pi
238.774392
Theta
167.27813
Tajima's D
1.236139
CLR
0.161417
CSRT
0.727113644317784
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号