SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10167
Pre Gene Modal
BGIBMGA005630
Annotation
PREDICTED:_sodium/potassium-transporting_ATPase_subunit_alpha-B-like_[Papilio_xuthus]
Full name
Sodium/potassium-transporting ATPase subunit alpha      
Alternative Name
Sodium pump subunit alpha
Location in the cell
PlasmaMembrane   Reliability : 4.601
 

Sequence

CDS
ATGACTCAAATAGGTAAAATAGCAGGACTTGTGACCGGATTGAAAAAAGAAGAGACACCGATCGCTAAAGAGATAACACATTTTATCAAACTCATCTGCGGAGTTGCGTTTGTCTTTGGTATAATATTTTTTGCGATGGTGTTTTTTACGCAACACCGTTGGATATCAGCTATTCAATACATGTTAGGAATTATACTTGCCAACGTACCAGAAGGCCTGATAGTAACATTGACAGTGTGCATGACTTTGTCGGCCAACCAGCTACAAAAGAAAAACTGTTTGGCCAAAAGCTTGCACGCTGTGGAAACATTGGGCTCCACATCGTGTATTTGCTCGGACAAAACCGGTACTTTGACTGAAAACCAAATGAAGGTTTCTCATTTGTTCTGTAATTTTAAGATTTACGACAGCGACGATTTTAGTCACGTATCTCAATCTACATACAGTGCGTTGTGTTTGGCAGCTTCCCTAAACCTTAAGGCGTTTTTTGGATTTGACTACTACGACGCTCCAATTGCAAAGAGAAAGATTTATGGTGACGCTTCGGAATCTGCGATATTGCGTTACATGGAACTGCATCGTTCAGCGACGTTGACGCGCGAAGATAACCCTAAGGAGGCGGAGATTCCTTTTAGTTCAGCATACAAATACCAAGTCACGATCCATCGAATGCAAGCCTCTCAAAGCTACTATTTGACAATGAAGGGTGCTCCCGAAATTGTACTAGATTATTGCACAACTGTGCACACCGACGAAGGAGAGCAGCCGTTGACTACACAAACGATCAAAGAACTGAAAGCATACTTTGTCAAATTGGCGAATATGGGCGAACGCGTTATTGGGTATTGCGATTTGAAACTACCGACAACTGATTATCCTCTTGGATACCAATTTGACACGCATCAACTTAATTTTCCCATTGAAAATTTACACTTTCTTGGATGTATATCGATGATTGACCCCCCTAGGAAGGATATAGCGAAAAGCATATCGATGTGTAGACAAGCAGGTATCAAAGTGATCATGATAACCGGTGATCATCCTGTAACGGCATTGGCTATTTCTCGTCAGTGCGGTACCATAACACAGCCCACTGTCTACGATTATGCCTTTGAGCATCACATTGAACTGTCCGATGTTCCATCGCACATAAAAAACCAGTTCAAAGCGGCCGTGATTACAGGCGACGAGCTGCGTAAAATGTCCGTCAACGAATTGAAGTCAGCGCTAGCTAAGTACGAGGAAATAACATTCGCAAGAACCAGTCCGCAGCAGAAGCTATTCATTGTGGAGACTTATCAGTCTTTGAAGTATATCGTGGCCGTCACTGGAGACGGCGTGAACGATTCTCCTGCATTAAAGAAAGCTGATATTGGAATAGCTATGGGCATCAACGGTACAGAGGTATCAAAGCAAGCTGCAGACATGATCTTATTGGACGATAATTTTTCGTCTATTGTGTTAGGAGTGCAAGAAGGAAGACGCATTTTCGATAATTTGAAGAAAACTATAGCGTATACGCTTACCTCGAACACTCCTGAAATGCTGCCTTTCGTTATGTACGCTTGTGTCGGAATGCCTTTACCGTTAACGTTGATGTTGATTTTGGTAATCAACGTTGGAACCGACTTGTTACCAGCCATGAGTTTGGCCTACGAGGATTCCGAAGAGGACATCATGTCGATCCCTCCCAGAAAACAGACCGATCATCTCGTTAACAAAGTTCTCCTTTTCATGGCCTATTTCCAAATAGGATTAATTCAATTTTTCGCTGGAATGTATGCGTACTTTGTAGTTTTCGCCAGAGAAGGATTCTTTCCGTCTAGTTTATTGTTCGTGCGTGATGATTGGGAATCTGATACTAAAGTAATCAGAGATTCAATTGGACGGTTATATTTTTATTCGGAGCGAAAACGAATCGAAAGGAAAGCGCAGACAGCCTACTTTGTGGCTATTTGCTTAACCCAAATATCTGACGTTTTAATATGTAAGACGAGGCGGATTTCGCTCTTCAAAAAAGGCATGAAGAACCAAGTTTTGAATGCTAGTATAGTTATTGATATATTTGCAGCAGTGACTGTCACTTATTTGCCATTGTGCAACGAAATTTTCGGCACGGAGCCCATCGATTGGTATTTATTTTTCCTTGCGGTACCGTTCATGGCGCTTATGATAATTGCGGACGAGATTAGGAGGTATTTAATTAGGAATAATATTTCCAAGTGGCTTGAAAAAGAAACGTATTACTGA
Protein
MTQIGKIAGLVTGLKKEETPIAKEITHFIKLICGVAFVFGIIFFAMVFFTQHRWISAIQYMLGIILANVPEGLIVTLTVCMTLSANQLQKKNCLAKSLHAVETLGSTSCICSDKTGTLTENQMKVSHLFCNFKIYDSDDFSHVSQSTYSALCLAASLNLKAFFGFDYYDAPIAKRKIYGDASESAILRYMELHRSATLTREDNPKEAEIPFSSAYKYQVTIHRMQASQSYYLTMKGAPEIVLDYCTTVHTDEGEQPLTTQTIKELKAYFVKLANMGERVIGYCDLKLPTTDYPLGYQFDTHQLNFPIENLHFLGCISMIDPPRKDIAKSISMCRQAGIKVIMITGDHPVTALAISRQCGTITQPTVYDYAFEHHIELSDVPSHIKNQFKAAVITGDELRKMSVNELKSALAKYEEITFARTSPQQKLFIVETYQSLKYIVAVTGDGVNDSPALKKADIGIAMGINGTEVSKQAADMILLDDNFSSIVLGVQEGRRIFDNLKKTIAYTLTSNTPEMLPFVMYACVGMPLPLTLMLILVINVGTDLLPAMSLAYEDSEEDIMSIPPRKQTDHLVNKVLLFMAYFQIGLIQFFAGMYAYFVVFAREGFFPSSLLFVRDDWESDTKVIRDSIGRLYFYSERKRIERKAQTAYFVAICLTQISDVLICKTRRISLFKKGMKNQVLNASIVIDIFAAVTVTYLPLCNEIFGTEPIDWYLFFLAVPFMALMIIADEIRRYLIRNNISKWLEKETYY

Summary

Description
This is the catalytic component of the active enzyme, which catalyzes the hydrolysis of ATP coupled with the exchange of sodium and potassium ions across the plasma membrane. This action creates the electrochemical gradient of sodium and potassium ions, providing the energy for active transport of various nutrients.
Catalytic Activity
ATP + H2O + K(+)(out) + Na(+)(in) = ADP + H(+) + K(+)(in) + Na(+)(out) + phosphate
Subunit
The sodium/potassium-transporting ATPase is composed of a catalytic alpha subunit, an auxiliary non-catalytic beta subunit and an additional regulatory subunit.
Miscellaneous
Ouabain-sensitive electrogenic ion pump.
Similarity
Belongs to the cation transport ATPase (P-type) (TC 3.A.3) family.
Belongs to the cation transport ATPase (P-type) (TC 3.A.3) family. Type IIC subfamily.
Keywords
Alternative splicing   ATP-binding   Cell membrane   Complete proteome   Ion transport   Membrane   Nucleotide-binding   Phosphoprotein   Potassium   Potassium transport   Reference proteome   RNA editing   Sodium   Sodium transport   Translocase   Transmembrane   Transmembrane helix   Transport  
Feature
chain  Sodium/potassium-transporting ATPase subunit alpha
splice variant  In isoform 2, isoform 3, isoform 6 and isoform 7.
EC Number
7.2.2.13
EMBL
BABH01020168    NWSH01000703    PCG74706.1    KQ461155    KPJ08283.1    JTDY01001365    + More
KOB74067.1    AGBW02012723    OWR44555.1    KQ459232    KPJ02649.1    ODYU01001126    SOQ36902.1    GDIP01218167    JAJ05235.1    GDIP01235472    JAI87929.1    GDIP01253205    JAI70196.1    GDIQ01078678    JAN16059.1    GDIQ01146812    JAL04914.1    GDIQ01162208    JAK89517.1    GDIP01168268    JAJ55134.1    GDIP01191161    JAJ32241.1    GDIQ01029055    JAN65682.1    GDIP01197974    JAJ25428.1    GDIQ01047502    JAN47235.1    GDIP01088280    JAM15435.1    GDIP01153779    JAJ69623.1    CAEY01000714    GDIP01109684    JAL94030.1    GFWZ01000215    MBW20205.1    GDAI01000902    JAI16701.1    UXSR01005651    VDD83150.1    GDIP01216015    JAJ07387.1    GDIQ01029056    JAN65681.1    GAKT01000064    JAA92998.1    DQ173925    ABA02167.1    GDIP01122237    JAL81477.1    DQ173924    ABA02166.1    CH902617    KPU79731.1    KPU79733.1    AF327439    AAG47843.1    GGFL01004280    MBW68458.1    EDV42459.1    GEFH01000672    JAP67909.1    GBXI01010944    JAD03348.1    JQ771508    AFU25677.1    CH954181    EDV48318.1    GBXI01008719    JAD05573.1    GAKP01010637    JAC48315.1    KN716280    KJH48096.1    GDIQ01191685    JAK60040.1    GDHF01005799    JAI46515.1    GAKP01010639    JAC48313.1    CM000160    EDW96202.2    GGLE01002529    MBY06655.1    JQ771506    AFU25675.1    GDHF01020773    JAI31541.1    KC691291    AGM39710.1    KPU79732.1    GAKP01010640    GAKP01010638    JAC48312.1    KRK02980.1    KZ150095    PZC73617.1    GFPF01011902    MAA23048.1    JQ771505    AFU25674.1    KA647445    AFP62074.1    JQ771507    AFU25676.1    HE962487    CCJ09645.1    KPU79736.1    GDIP01107486    JAL96228.1    GL732613    EFX71104.1    EF672699    ABV65906.1    KRK02982.1    GGFL01001054    MBW65232.1    CH916373    EDV94529.1    JX173959    AGF90965.1    AAZO01003918    DS235340    EEB14976.1    X14476    AF044974    AE014297    AY069184    AY174097    AY174098    U55767    X17471    JOJR01000021    RCN50576.1    GEDV01008478    JAP80079.1    CH480853    EDW51636.1    GFJQ02000574    JAW06396.1    AGB96170.1    NWSH01000562    PCG75639.1    BT133381    AFH36366.1    KRK02979.1    KRK02985.1    KRK02987.1    KPU79735.1    UYSL01020061    VDL72459.1    AAZO01004204    DS235366    EEB15339.1    PCG75638.1    PCG75637.1    JQ771525    AFU25694.1    GDIP01174410    JAJ48992.1    GDIP01174412    JAJ48990.1    GDIP01174411    JAJ48991.1   
Pfam
PF00689   Cation_ATPase_C        + More
PF00690   Cation_ATPase_N
PF00379   Chitin_bind_4
Interpro
IPR004014   ATPase_P-typ_cation-transptr_N        + More
IPR008250   ATPase_P-typ_transduc_dom_A_sf       
IPR006068   ATPase_P-typ_cation-transptr_C       
IPR023298   ATPase_P-typ_TM_dom_sf       
IPR001757   P_typ_ATPase       
IPR023299   ATPase_P-typ_cyto_dom_N       
IPR036412   HAD-like_sf       
IPR023214   HAD_sf       
IPR005775   P-type_ATPase_IIC       
IPR018303   ATPase_P-typ_P_site       
IPR031311   CHIT_BIND_RR_consensus       
IPR000618   Insect_cuticle       
SUPFAM
SSF81653   SSF81653        + More
SSF56784   SSF56784       
SSF81665   SSF81665       
SSF81660   SSF81660       
Gene 3D
PDB
3WGV     E-value=0,     Score=1850

Ontologies

Topology

Subcellular location
Membrane  
Cell membrane  
Length:
749
Number of predicted TMHs:
6
Exp number of AAs in TMHs:
134.31717
Exp number, first 60 AAs:
23.51722
Total prob of N-in:
0.87923
POSSIBLE N-term signal
sequence
inside
1  -  27
TMhelix
28  -  50
outside
51  -  59
TMhelix
60  -  82
inside
83  -  515
TMhelix
516  -  538
outside
539  -  577
TMhelix
578  -  600
inside
601  -  678
TMhelix
679  -  698
outside
699  -  707
TMhelix
708  -  727
inside
728  -  749
 
 

Population Genetic Test Statistics

Pi
229.310996
Theta
192.441454
Tajima's D
0.456993
CLR
0.056902
CSRT
0.500174991250438
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号