SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10144  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA005637
Annotation
Protein_penguin_[Papilio_xuthus]
Location in the cell
Nuclear   Reliability : 3.643
 

Sequence

CDS
ATGCAGAAAGGTAAAAGGAAAAGTGATGAAGATGGTGTTAGTTCACCAAAAAAGAAAAAACTAAATAGTTCGCATGAACAAGATAATAAAGTTAAAAACATCAAAAACAAAATAAACCTAAAAGGTAAAAAATTTAATAAGGATGGAGTAAAAGGTTTCAAAAAATTTACTAAAAACGACAAAGGATCTAAATTTGTTAAAACAAAAGAAAAATCGAATTTTTCTAAAGATGAAGCAAACGGAGAAAAGCCAAAATGGGCTGAAATGAAAAAAGAGAAAAAACAACTAAGGACTGTCAGACGTAAAGCCAAAATAACAGCTGAAGTATTTGAGATTTCACATAAGGCCAAGTTGTTAGCAGCACAAATACAGAGAAAAGTTGTGAAATCTGACTTCAAAATAAACTCCTGTAAAGAATTGCACAATATGTTAAAGGGACAATACAAGTCTATTGCTCTCACACATGATCTTAGTCGAGTTATTCAAGTTCTACTAAAACATAGCCCTGAAGACATTATAAATGAAATAACGAAAGAGCTTCTAGACATTATAGTACAGATGGGTCAATCTAAGTACGCGCATCATTCCGTTAAGCGAATACTGAAATATGGAACAGATTTCATTCGGCATGAGGTTTTGAAGAAGTTTTATGGACATGTTGTATCCCTGTCAACTCATGCTATTAGTGCACCTGTCTTGGATTATGCATATGGGGAGTTTGCCTCGAAAAAGGAAAAATGCCACATGCAACAAGAATTCTATGGAGAGATTTATAAGAATACAAAAGACGACAAGGTAAAGACACTCAGAGATGCATACAAAGACAGTCCAGAAATGAAATCAGCTATACTCCAGGCCTGTAAGACCAACTTACAGAAGATATTAGACAAAAACCTACATGATGGAGAATTGTTTCATTCTGTGTTATATGACTATATCTGTGAATGCAGCCAAGAAGATAGAGTAGATTTTATTTCTATTCTTAGCCCACTGATTGTCCCACTCAGTAATTCTTTACCTGGTGTCAATGCTGCCAGTATGTGCGTTTGGCAGGGTACAAATAAGGACAAGAAAACAATTTTAAAAGTGGTCAAGGAACATGCTATTCCTTTAAAAGACTATTGTGTCCACTCTGGCTGCCAATATAAAGACATTGCTAAGGACCACTGGGGTAATATGGTAATTCACTGGTTAGTAAAACCAAAAGACACAGCTGCTTTCCATCCTAGTTTAATTAAGTTTTTGGAAGATGGTGCTAAGAGTGGAACATCGAAGAAAGACACAGAAATTCGTGTTTTGGAGCTTAGGGAAGCTATATTACCTGCTCTAAAGAAAGATATGGAAACAGATCCTAAATTCTGGCTAAGCAATAAATCTAATATGTTGTTGGCTGTTGCTGTATTGTCTATAGAATCATCTAAAGAGATTCTGCATGCATTGGCAAAAGTGATCTGCGAGACTGACTGGCACATGCAGGTGGAAGGGAAGGACGATACCCTGGCGATTGAGGATGCTGGCATACACATGTGCTTAAAAAAACTAGCCAGTTTAGACAAAGAAAAATCGGCTGATACTCTTGGTGAAGCTATAAGTGAACATTTAAATGATGAAACTATTAAAGTGTGGATACGTACAAATAGGGGTTGCTTTTTCCTATTGAAATTGATAGAGAGTAATCGTGAAGAAGTAGCTAAGAAATTAAAAGCAAAATTAAAACCACATGTAAATATTTTGAAGCAACAATCATCGGAAGGTGCTAAATTATTGTTACAGAATGTACAGAATAAATAG
Protein
MQKGKRKSDEDGVSSPKKKKLNSSHEQDNKVKNIKNKINLKGKKFNKDGVKGFKKFTKNDKGSKFVKTKEKSNFSKDEANGEKPKWAEMKKEKKQLRTVRRKAKITAEVFEISHKAKLLAAQIQRKVVKSDFKINSCKELHNMLKGQYKSIALTHDLSRVIQVLLKHSPEDIINEITKELLDIIVQMGQSKYAHHSVKRILKYGTDFIRHEVLKKFYGHVVSLSTHAISAPVLDYAYGEFASKKEKCHMQQEFYGEIYKNTKDDKVKTLRDAYKDSPEMKSAILQACKTNLQKILDKNLHDGELFHSVLYDYICECSQEDRVDFISILSPLIVPLSNSLPGVNAASMCVWQGTNKDKKTILKVVKEHAIPLKDYCVHSGCQYKDIAKDHWGNMVIHWLVKPKDTAAFHPSLIKFLEDGAKSGTSKKDTEIRVLELREAILPALKKDMETDPKFWLSNKSNMLLAVAVLSIESSKEILHALAKVICETDWHMQVEGKDDTLAIEDAGIHMCLKKLASLDKEKSADTLGEAISEHLNDETIKVWIRTNRGCFFLLKLIESNREEVAKKLKAKLKPHVNILKQQSSEGAKLLLQNVQNK

Summary

EMBL
NWSH01001832    PCG69966.1    ODYU01003152    SOQ41542.1    KQ459232    KPJ02633.1    + More
KQ461155    KPJ08300.1    FP102340    CBH09284.1    KC469893    AGC92694.1    GAIX01003617    JAA88943.1    AGBW02013517    OWR43288.1    JTDY01000686    KOB76223.1    KQ971363    EFA09038.1    LJIG01016117    KRT81565.1    APGK01041594    KB740994    KB632255    ENN75986.1    ERL90654.1    GEZM01035601    JAV83159.1    NNAY01001792    OXU22907.1    AAZX01002711    GL451265    EFN79580.1    JR041372    AEY59426.1    KZ288391    PBC26358.1    LBMM01014327    KMQ85219.1    KQ434896    KZC10744.1    GL762880    EFZ20617.1    GL437382    EFN70542.1    GDHF01022839    JAI29475.1    KQ980989    KYN10708.1    GL888186    EGI65579.1    QOIP01000010    RLU18102.1    KK107374    EZA51594.1    GAKP01015149    GAKP01015145    GAKP01015141    JAC43803.1    KQ976528    KYM81867.1    ADTU01024454    KQ981208    KYN44654.1    NEVH01013260    PNF29156.1    GANO01003004    JAB56867.1    KQ983136    KYQ47082.1    UFQT01001175    SSX29325.1    UFQT01001201    SSX29481.1    RLU18103.1    GAMC01010297    GAMC01010295    JAB96258.1    KK853308    KDR08684.1    KQ978457    KYM93817.1    GFDF01008496    JAV05588.1    AJVK01011378    AJVK01011379    AJWK01018717    CVRI01000066    CRL05875.1    GDHF01002204    JAI50110.1    JXUM01114779    JXUM01114780    JXUM01114781    JXUM01114782    JXUM01114783    JXUM01114784    KQ565817    KXJ70629.1    KA644763    AFP59392.1    PNF29155.1    CCAG010007360    JRES01000777    KNC28412.1    CH477622    EAT38180.1    CH964239    EDW82601.2    CH916371    EDV92461.1    CH940660    EDW58044.1    CH379064    EAL31927.2    FJ821026    ACN94646.1    OUUW01000039    SPP89917.1    SPP89916.1    GEBQ01022642    JAT17335.1    GFDL01014579    JAV20466.1    GL732528    EFX87453.1    GDIP01092481    JAM11234.1    GDIP01227270    JAI96131.1    GDIP01025106    JAM78609.1    GDIP01210276    JAJ13126.1    LRGB01001581    KZS11152.1    GDIQ01094329    JAL57397.1    GDIQ01059302    JAN35435.1   
Pfam
PF08144   CPL
Interpro
IPR040059   PUM3        + More
IPR016024   ARM-type_fold       
IPR001313   Pumilio_RNA-bd_rpt       
IPR012959   CPL_dom       
IPR011989   ARM-like       
IPR033133   PUM-HD       
SUPFAM
SSF48371   SSF48371       
Gene 3D
PDB
4WZW     E-value=7.74832e-39,     Score=405

Ontologies

Topology

Length:
596
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.15473
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01148
outside
1  -  596
 
 

Population Genetic Test Statistics

Pi
340.212503
Theta
172.649669
Tajima's D
2.881752
CLR
0.000821
CSRT
0.974401279936003
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号