SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10141
Annotation
PREDICTED:_uncharacterized_protein_LOC105841762_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.159 Nuclear   Reliability : 1.784
 

Sequence

CDS
ATGGAGCAACTGCAGGCACTATACACTTCCGTCCAAGTAGAAAACGCGGAGCTTCGTGCGGAGAGTGCTCGGGTGCGGGAGGAGATGGCCAGGATGCGTGTGGTCCTTGACGATGTCGTGGGATGCCAAGGCAGCTCGGCCTCTCCGCCACCCGTGCCCTCACCGCAGGAAGCAACGGATAAAGACCGCGAGATAGAGGAACTAAAGAGGTGTCTCGCGATAATGGAGGCCCGCACGTCTACGGTGGAACGCGCAAGGCCTCCACTGGCGCACGAGCGGCCTGTGCCCACAATGCGACAGCGACCGCAGTTGTACCAGCGCCCACGGGGGCTGCAGCCAAGCAATGGGTCGAGCGACGACTGGGGGAGGGAGAAAAGGGCGCAAGGTGAAGAAACCGCGCGCCCCACGGTCGGCAGCGGTCGTATTAGAACTGCTGCCGGCTGGCAAGGAAAAGGGCCTCACCTATGGGAGGTGATGGCTCGGGCGCGCGGTAGCGTCGACGTTGACGCCATAGGTGTGGAAGGGGGACTCCGAGTCCGGCAGACGGCCAGCGGGGCTCGGCTGTTGGTATGTCCTAGTGCTGACTCCGGCGCGGCCGCAGACAGACTGGCAGCCCGGCTTCGCGAAATTCTGCCGGACCCGGAAGTGGTGCGCATAGATAGGCCTGTCAAGATGGCGGAAGTCAAAGTGACGGGCCTGGATGAATGTACCACTAAGGAGGAAGTGGCCGCCGCTATTGCGTCGCAGGGCAACTGCGCCCTCGCACAGTGA
Protein
MEQLQALYTSVQVENAELRAESARVREEMARMRVVLDDVVGCQGSSASPPPVPSPQEATDKDREIEELKRCLAIMEARTSTVERARPPLAHERPVPTMRQRPQLYQRPRGLQPSNGSSDDWGREKRAQGEETARPTVGSGRIRTAAGWQGKGPHLWEVMARARGSVDVDAIGVEGGLRVRQTASGARLLVCPSADSGAAADRLAARLREILPDPEVVRIDRPVKMAEVKVTGLDECTTKEEVAAAIASQGNCALAQ

Summary

Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
SUPFAM
SSF57756   SSF57756        + More
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
256
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0
Exp number, first 60 AAs:
0
Total prob of N-in:
0.03728
outside
1  -  256
 
 

Population Genetic Test Statistics

Pi
2.304539
Theta
3.079752
Tajima's D
-0.646172
CLR
20.130718
CSRT
0.212639368031598
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号