SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10139
Pre Gene Modal
BGIBMGA005640
Annotation
Cockayne_syndrome_protein_[Operophtera_brumata]
Location in the cell
Nuclear   Reliability : 3.839
 

Sequence

CDS
ATGGTGGACATAAACAAATATTTAGAAATGCAACTTGAATTAGCGAAAAAGCAAATTGAGAGGAAAAATAGTCAGAAAGAAGATGTATCAACTAAAAGCAAATCTGCTGCTGATTACATATCGCAAAAACAGGCAAAGACTCTGTCAAAATTTCCTCACAATCAAAAAGTAGATGTAAAAACTACTGTGACATCAGGGACTTCAACTGAAGGACACCTCGATGACATCGATTTTGTACCTTCCGATGAGGAAGACGAAAGTATCCATAATTTTCCGCTTACTGCGTGTTCTTCTCGTACCAAACAGAATATAAACCGAATTGTTGACGACGGTGATATTAAACAATACAATTTAAGGGTAGAGGTTTGGCGTGAAGGATTAAATACTGTGAAAAGCGGTACATATGAAGGATGCTCGTTAACCGCTGACATACAGTACATCCTGGATGGTAATAAAGATAGCGAAGAAATGCATGAACTCCAGAATGGTCTATTAGTACCAAAATATATTTGGAAACAGTTATATAAATTTCAAAGAACTGGTGTTAAATGGCTTTGGGAGTTGCATCAAGTGGAGTCTGGTGGATTGTTAGGTGATGAAATGGGACTTGGTAAAACAATACAAGTCATTGCATTCCTCACCGCCCTTTCAAAAACCAATTTAGGATCATGGGGCGGTCTTGGTCCGAGTATCATTATCACACCTGCAACGGTTATATATCAATGGGTATCTCATTTTCATTATTGGTGCCCCCTGCTCAGAGTAGCTGTACTGCATCACACTGGCTCTCATGCTGGTAATCACCATAAACTATTAAGGGATATACACAGTGCTCATGGAATCTTGTTAGTAACATATGCAGGCATAGTAAAGTATCATAAAGAACTCAATGCCTATAGTTGGCATTATTTAATTTTGGATGAAGGACACAAAATACGTAATCCTGATACACAAGTAAGTAAAATTGTAAAAAAAATCCAGACACCACACAGATTGTTAATAACAGGTTCACCAATGCAGAACAGTTTGCAGGAACTGTGGTCATTATTTGATTTTATGAGGCCAGGTTTGTTGGGGACATACAATGCATTCATAGAACATTTTGCAGTTCCAATCACTCAAGGAGGCTATGCTAATGCTACTGAAATACAGGAAGCTACTGCCATGGAAATAGCTATTGCTTTGAAAAATATGATCACTCCTTACATGCTGAGGAGAACTAAGGCTGAGGTACAAGGACATATCAAACTCCCAGAAAAGAATGAACAAGTTCTATTCTGTTCTTTAACACAAGAGCAAAGAGATCTTTATATGGGTTACCTTATGAGTAGTACAGTGAGAAGCATCTTAGACAAAGAAAATAAATTTGGAAATCCATTAAGAGCAAGGCTACTAGTGGCTCTGTCAACGCTAAGGAAAATATGCAATCATCCTGATATTTATCTCTATGAAGCTCAAGAAGATGAAGAACAGATAGATGAAGAGATATTTGGCCATTGGAAGAGATCTGGAAAAATGACTGTTGTTAATTCATTACTTAAAATATGGAAAAAACAGGGACATAGAGCTCTCATATTCTCTCAGTCAAGAGTAATGCTGTGTCTGTTAGAACAGTATTTACAAAATCAAGGCTTTAAATACCTCAAAATGGATGGTACAGTTAATGTTGGCCAAAGGCAAAACTTGATTAAAACTTTTAATGATAACACTGATTATTTAGTTTTTCTTTCAACAACTAGAGTAGGTGGCTTAGGTGTAAATTTAACTGGAGCCGACAGAGTGATTATATATGATCCTGATTGGAATCCTGCAACAGATGATCAAGCAAAGGAAAGAGCATGGAGGATAGGCCAATCTAGAAATGTAACAGTTTATAGATTGTTGTCAGCTGGGACTATAGAGGAAAAGATTTATCAGAGGCAGATATTCAAACATTTCTTGAGTAATAAAATTTTTGTGGACCCAAATCAAAAGAATTTTTTGACCACCAGTACATTACAGGGACTGTTCACTCTTGAAGAGCTTAACCGTGACGGAGATACTGAAACTGCATCAATTTTTAAACACACCAAAATTATCAATAAAACCAATAAGGATGATAATGACTTGGATATTTCATCTAAAACAAAGTTAGAAGCCATGAAAAGATTAGCAAAAGAAATAAGTAAAAAAATATCAAAAGAATCCATGAAGGGAACACAGGAAAGTGATCCACGTGAAGAATATAAAAAGAAAAGAGAACAATTATTATGTCCACCTAAAGTGGAAGAACCAGATATTAATTTAGTTGATGATAAAATAACCAATGTAGCTTTTGAAGATGTTTTGTCAGAATTAGATATTGTAAAAATGCATGCAAAGAAAGATTATGAAGAACAATTGTTGAAAAGTGTACTAGAAGATAGTGAACAAGATATTAAAGAAGTAGATGAAGAGAAACCTACCAACATTGACAACTCTCAACTTGAAACTAATGAAAGTACTGTAAAAGATATTAAACAAAGGCATAAAAAATCACATAAAATAAAGCGCAAAAGAAGATTATCATCTTCCATTGATGATGGACTCAAAAATTTAGTAACTGTAAAGAAAGTAAAGAAAAGGATTATAGTAAAAATGAAGTAA
Protein
MVDINKYLEMQLELAKKQIERKNSQKEDVSTKSKSAADYISQKQAKTLSKFPHNQKVDVKTTVTSGTSTEGHLDDIDFVPSDEEDESIHNFPLTACSSRTKQNINRIVDDGDIKQYNLRVEVWREGLNTVKSGTYEGCSLTADIQYILDGNKDSEEMHELQNGLLVPKYIWKQLYKFQRTGVKWLWELHQVESGGLLGDEMGLGKTIQVIAFLTALSKTNLGSWGGLGPSIIITPATVIYQWVSHFHYWCPLLRVAVLHHTGSHAGNHHKLLRDIHSAHGILLVTYAGIVKYHKELNAYSWHYLILDEGHKIRNPDTQVSKIVKKIQTPHRLLITGSPMQNSLQELWSLFDFMRPGLLGTYNAFIEHFAVPITQGGYANATEIQEATAMEIAIALKNMITPYMLRRTKAEVQGHIKLPEKNEQVLFCSLTQEQRDLYMGYLMSSTVRSILDKENKFGNPLRARLLVALSTLRKICNHPDIYLYEAQEDEEQIDEEIFGHWKRSGKMTVVNSLLKIWKKQGHRALIFSQSRVMLCLLEQYLQNQGFKYLKMDGTVNVGQRQNLIKTFNDNTDYLVFLSTTRVGGLGVNLTGADRVIIYDPDWNPATDDQAKERAWRIGQSRNVTVYRLLSAGTIEEKIYQRQIFKHFLSNKIFVDPNQKNFLTTSTLQGLFTLEELNRDGDTETASIFKHTKIINKTNKDDNDLDISSKTKLEAMKRLAKEISKKISKESMKGTQESDPREEYKKKREQLLCPPKVEEPDINLVDDKITNVAFEDVLSELDIVKMHAKKDYEEQLLKSVLEDSEQDIKEVDEEKPTNIDNSQLETNESTVKDIKQRHKKSHKIKRKRRLSSSIDDGLKNLVTVKKVKKRIIVKMK

Summary

EMBL
BABH01020201    JTDY01000686    KOB76216.1    NWSH01001832    PCG69965.1    HM449870    + More
ADO33005.1    KC469893    AGC92693.1    KQ461155    KPJ08306.1    KQ459232    KPJ02627.1    FP102340    CBH09283.1    ODYU01003152    SOQ41541.1    AGBW02013517    OWR43289.1    KQ971354    EFA07002.2    KQ434998    KZC13269.1    NNAY01000390    OXU28718.1    KZ288232    PBC31516.1    KQ414905    KOC59628.1    GEZM01088381    JAV58228.1    NEVH01019065    PNF23187.1    GBYB01013814    JAG83581.1    KQ982696    KYQ51971.1    GEZM01088380    JAV58230.1    KK107388    EZA51499.1    GEDC01008947    JAS28351.1    GL888182    EGI65656.1    KK853134    KDR10852.1    ADTU01013257    ADTU01013258    KQ976401    KYM92518.1    KQ978023    KYM97864.1    KQ979851    KYN18853.1    FX985816    BBA93703.1    ABQF01027374    ABQF01027375    ABQF01027376    ABQF01027377    ABQF01027378    ABQF01027379    ABQF01027380    MUZQ01000106    OWK58211.1    AGTO01000148    KK839952    KFP82644.1    KL447250    KFO71011.1    KK718105    KFO54269.1    KL215552    KFV65211.1    KK755005    KFP43029.1    KL672532    KFW85930.1    AADN05000339    KK501886    KFP18652.1    KK505808    KFP61313.1    QUSF01000014    RLW03973.1    KL409688    KFQ91270.1    LSYS01003057    OPJ84447.1    KL872592    KGL96282.1    CR762493    KK690606    KFQ16455.1    KK645687    KFP98775.1    KK436209    KFQ90314.1    KL424518    KFW89922.1    KK443449    KFQ70947.1    KL206495    KFV82828.1    KL267025    KFZ62302.1    ADON01089224    ADON01089225    KL218641    KFP07189.1    GDIQ01039149    JAN55588.1    GDIP01041139    JAM62576.1    GDIP01159619    JAJ63783.1    GDIP01025796    JAM77919.1    LRGB01000642    KZS17136.1    KQ435922    KOX68657.1    GDIP01160127    JAJ63275.1    AHAT01025219    AHAT01025220    KB743335    EOA99371.1    KL226002    KFM06464.1    GDIP01168821    JAJ54581.1    GDIP01168822    JAJ54580.1    GDIP01168116    GDIP01167218    JAJ56184.1    GDIP01167217    JAJ56185.1    KL504946    KFO84504.1    KL224536    KFW60990.1    GDIP01168115    JAJ55287.1    KB030894    ELK08347.1    CM004478    OCT72187.1   
Pfam
PF00176   SNF2_N        + More
PF00271   Helicase_C
Interpro
IPR014001   Helicase_ATP-bd        + More
IPR001650   Helicase_C       
IPR027417   P-loop_NTPase       
IPR038718   SNF2-like_sf       
IPR000330   SNF2_N       
SUPFAM
SSF52540   SSF52540       
Gene 3D
PDB
5VVR     E-value=2.78165e-132,     Score=1212

Ontologies

Topology

Length:
874
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.85405
Exp number, first 60 AAs:
0
Total prob of N-in:
0.08063
outside
1  -  874
 
 

Population Genetic Test Statistics

Pi
19.739753
Theta
33.3508
Tajima's D
-1.157369
CLR
111.178279
CSRT
0.112094395280236
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号