SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO10137
Pre Gene Modal
BGIBMGA005562
Annotation
PREDICTED:_uncharacterized_protein_KIAA0195?_partial_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 4.388
 

Sequence

CDS
ATGCTCACACAGGGTACCGCAGATATAGTGTTAGACTCGTGCGTAGATTACTGGAACGGGCGGGACTTAACACCGATATCTGCTTCCGACCGAAAGAAGATCATAGATTTTTACCAAAGAAACTCACTGACGGCCTATTGTACCGCTTTCGCTTACAAGCCGGTGACGCGCGGCGTGTCGTCGCCCGTGGCGGACATGTACCTGGAGGTGCCGGCGGAGGGGCGCGGGGGGCTGGCGCCGCGCACGCAGCACTGGCCGGACGCGCCCGCACTGCACTTTCACTCAACTGATTCCCTACTGTTCAATGAAGTGACCGACGACGATGTTGTTGACGCCGATGGATATTTCGATCTGCAATGCAATCAAGTGTTCATAGGCATGGTGACGATGCAGTACCAGGCGCAGAGCGACATGGTGGAGCTGATAGAGCGGCTAGAGCGGGCCTGCATACGCTTCGTCCACTTCAGCAAGGAGAACGAGCTCCGGTCGAGGGTGTTCAGCGAAAAGATGGGCTTGGAGTCCGGCTGGAACTGTCACATATCGCTCATGAGCGACACCGAAGCCAGCAAAAGCGCATCGCCGCTGTCCTCGCAGAATATCGCGCAGCCAAAGGAACCTAACATCGAGAGGCGGCCCTCTAGGGGCTTCGAAACTTTTGACGCTCTCGGCTTTTGTCATAGCAATAGTATGGCAACATCGAAAGCGTTGTCTATGTCGGCGCCGGGAGCGATCAATCTAGATCACACTACCGTCAAATTCGACAACGAGGTCAAGAAAGCGAGGCACTCCATCACAACTGGAATCAAGATGCAGCGTGGCAGCATAGCGACGACGCATCCGTCGGCGGACTCGGCTCTGGACTCGCGCGAGGAGCCGGAGTCCCCGGTGGACGCGTGCCGCTCGCTGTCCTGCCTCACCGACTCCACCGACCACTCGGCGCAGCTCAACTTCGACATGAGCAATAGGGCTAAGTTGCCCCGCGGCATCGAGAACATCCGACCCCACATCGAGCAAGTGGACAACGTTCCGCTCCTCGTCTCGCTGTTCACGGACTGCACCGCGCGCTCCGTCCAGCTCATGATACAGATCATGCAGGATTACAGCGAGGTGGTTTGCGTGATGGGCTCCGCGGCCAACTGTCTCAACATGGAAATCTTCATGCAGGCCGACGCTAGCATCGCGGTTGAGCCTCTATATCCGGTACTGTGCCAAAAGATGCAACCGTACTTGATTCCCGACTCCTGCATCGGTCCCATCGACCTAGCTAGAGCACTCAATTCGGTCCCCTGTTCTTTGTCGATGACGCGGGAATCGGATCTGTCACTGTTCACATTAATAACGACGTCGCGTCACTTCATGACGTGCCTGTGGAACTGCACTCAGTTCTGGATATGCAGCGTTTGTTTCATAGCCCTGTTACAGACAGGTTCCCTGTGCGGGTTCTTGCCGCTGGCGCTGAGCGTGGGCGGCGCGGCGTGGTGCGGGCTCGTGTCGGTGCCGCACGTGGCGGGCGCGCTCGCCCTCGCCCCTCCGCACCCCGCGCTCTCCCAGCGCGCTGCCACCAGGCCAGACCATCAGCTGAACCTCAAGATGGCGGTGTTCGTGTTCTGGTGCTACGCGTGCAAGTTCGTGCCGGCCGCCGTCTCCATCCTCGTGCTGTACGGGCTGACGCTGCGCAGCTTCTGCGAGCAGATCGCGGCCGCCACCAACGCGACGTCGTGCTGGATCGTGTACCCGGTGAACGTGGGCGCGTTCCCGCCCAGCCACGACCTCACCGCGAGGAGCTGGCACGGCTGGGGCGACGACTTCTACGACGGATTCTATTTGACCCAACATATCGTGCTCGCTTTGATAACTTTGCATTTAATTGTGATCTCATTATCATTCGTCCATCGCTACTCGTCGATATGGCAACGTGGCTTCTGGACCAATCGAGCGTGGACTATCACTGTTGTCGTACTGCTGGTAGTCCAGTGCGCGTTCAGCGGCGTGATGCTGAGCGGCACGTACGGGTCGTGCGCGCGCTGGTCGGTGTGCGCGCTGCGGTACCGCGTGCCGTGGCCGCTGCTGCTCGCGTACGCCGCCTCGCTGCTGCTCGTGCTCGCGCTCAACGAGCTCATCAAGTGGCAGGAGATCAAGGCAGACAGACGGAATCAACGCCGCGCCCGCCTCGATTTCGGAACCAAACTGGGAATGAATTCTCCATTCTAA
Protein
MLTQGTADIVLDSCVDYWNGRDLTPISASDRKKIIDFYQRNSLTAYCTAFAYKPVTRGVSSPVADMYLEVPAEGRGGLAPRTQHWPDAPALHFHSTDSLLFNEVTDDDVVDADGYFDLQCNQVFIGMVTMQYQAQSDMVELIERLERACIRFVHFSKENELRSRVFSEKMGLESGWNCHISLMSDTEASKSASPLSSQNIAQPKEPNIERRPSRGFETFDALGFCHSNSMATSKALSMSAPGAINLDHTTVKFDNEVKKARHSITTGIKMQRGSIATTHPSADSALDSREEPESPVDACRSLSCLTDSTDHSAQLNFDMSNRAKLPRGIENIRPHIEQVDNVPLLVSLFTDCTARSVQLMIQIMQDYSEVVCVMGSAANCLNMEIFMQADASIAVEPLYPVLCQKMQPYLIPDSCIGPIDLARALNSVPCSLSMTRESDLSLFTLITTSRHFMTCLWNCTQFWICSVCFIALLQTGSLCGFLPLALSVGGAAWCGLVSVPHVAGALALAPPHPALSQRAATRPDHQLNLKMAVFVFWCYACKFVPAAVSILVLYGLTLRSFCEQIAAATNATSCWIVYPVNVGAFPPSHDLTARSWHGWGDDFYDGFYLTQHIVLALITLHLIVISLSFVHRYSSIWQRGFWTNRAWTITVVVLLVVQCAFSGVMLSGTYGSCARWSVCALRYRVPWPLLLAYAASLLLVLALNELIKWQEIKADRRNQRRARLDFGTKLGMNSPF

Summary

EMBL
NWSH01001832    PCG69963.1    BABH01020203    BABH01020204    BABH01020205    BABH01020206    + More
RSAL01000090    RVE48102.1    KQ461155    KPJ08304.1    KC469893    AGC92690.2    FP102340    CBH09281.1    AGBW02013517    OWR43291.1    KK853134    KDR10862.1    NEVH01020858    PNF21038.1    PNF21040.1    PNF21041.1    PNF21037.1    KZ288308    PBC28715.1    NNAY01002685    OXU20778.1    KQ759847    OAD62585.1    KQ414784    KOC61013.1    GL445515    EFN89491.1    QOIP01000007    RLU20670.1    KQ977171    KYN05181.1    GL888167    EGI66276.1    KQ976604    KYM79404.1    KQ981561    KYN39827.1    ADTU01020204    GBYB01001768    JAG71535.1    KQ982109    KYQ60000.1    KK107238    EZA54621.1    GBYB01009580    JAG79347.1    GBYB01001767    JAG71534.1    GEDC01000814    JAS36484.1    GEDC01023274    GEDC01010258    JAS14024.1    JAS27040.1    GEDC01031434    GEDC01026722    JAS05864.1    JAS10576.1    KQ435834    KOX71551.1    PNF21039.1    GFTR01008638    JAW07788.1    GEDC01030912    GEDC01010908    JAS06386.1    JAS26390.1    GEDC01026348    JAS10950.1    GBBI01003783    JAC14929.1    GL434335    EFN74998.1    PYGN01002942    PSN29814.1    DS235392    EEB15529.1    GEZM01101576    GEZM01101573    GEZM01101570    GEZM01101569    GEZM01101566    GEZM01101565    GEZM01101553    GEZM01101549    GEZM01101547    JAV52508.1    GEZM01101567    GEZM01101556    JAV52523.1    LJIG01001147    KRT85793.1    GBHO01045650    GBHO01045645    GBHO01026686    GBHO01026683    GBHO01026682    GBHO01026681    GBHO01026680    GBHO01026678    JAF97953.1    JAF97958.1    JAG16918.1    JAG16921.1    JAG16922.1    JAG16923.1    JAG16924.1    JAG16926.1    GDHC01006927    JAQ11702.1    GDHC01007108    JAQ11521.1    GDHC01003801    JAQ14828.1    ACPB03015962    ACPB03015963    KK854009    PTY09219.1    KQ971361    EFA08800.1    ABLF02027300    GGMR01012391    MBY25010.1    GECU01011041    JAS96665.1    GECU01032144    JAS75562.1    CH902624    KPU74432.1    CH477589    EAT38586.1    CM000157    KRJ97269.1    CH477937    EAT34941.1    CM002910    KMY88057.1    CH379060    KRT04430.1    CH954177    KQS70089.1    CH940649    KRF81941.1    JH431601    KA648401    AFP63030.1    KPU74431.1    KPU74433.1    KPU74430.1    EDV33368.1    EDW87631.1    KRJ97268.1    GDUN01000178    JAN95741.1    APGK01022082    KB740398    ENN80731.1    KB632255    ERL90630.1    KMY88058.1    KMY88056.1    CH933807    KRG03524.1    AXCN02001394    DS231854    EDS37996.1    GAMC01018438    JAB88117.1    GFDL01009689    JAV25356.1    GFDL01009707    JAV25338.1    KQS70090.1    EDV57725.1    GEBQ01028201    JAT11776.1    GFDF01011093    JAV02991.1    CP012523    ALC38747.1    CH480820    EDW54230.1    AAAB01008846    EAA06333.5    GAMC01018439    JAB88116.1    BT122083    ADE06689.1    AXCP01007583   
Pfam
PF00689   Cation_ATPase_C        + More
PF01027   Bax1-I
Interpro
IPR039720   TMEM94        + More
IPR023299   ATPase_P-typ_cyto_dom_N       
IPR023298   ATPase_P-typ_TM_dom_sf       
IPR008250   ATPase_P-typ_transduc_dom_A_sf       
IPR006068   ATPase_P-typ_cation-transptr_C       
IPR006214   Bax_inhibitor_1-related       
SUPFAM
SSF81660   SSF81660        + More
SSF81665   SSF81665       
SSF81653   SSF81653       
Gene 3D

Ontologies

Topology

Length:
736
Number of predicted TMHs:
7
Exp number of AAs in TMHs:
151.93041
Exp number, first 60 AAs:
0.00697
Total prob of N-in:
0.07083
outside
1  -  459
TMhelix
460  -  482
inside
483  -  488
TMhelix
489  -  511
outside
512  -  530
TMhelix
531  -  553
inside
554  -  565
TMhelix
566  -  588
outside
589  -  607
TMhelix
608  -  630
inside
631  -  650
TMhelix
651  -  670
outside
671  -  684
TMhelix
685  -  707
inside
708  -  736
 
 

Population Genetic Test Statistics

Pi
277.131689
Theta
147.259594
Tajima's D
2.785931
CLR
0.105367
CSRT
0.967351632418379
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号